Description :
From Genome Similarity Track
Location :
Scaffold_681:9709- 11166
Transcript NameFunction/comments
Phypl_g10282hypothetical protein PHYSODRAFT_469730

Sequence
1457 bases(100 bases per row)
TTCCAGTCTGGCCGCCCAAAGTGCGTTTGCTGTTTCGTATGAAGTCCCGAGATAATATCTTGTCCTTCAGCGTTGTGAATAAAGTGCTGCAACGCTTGCA
ACGGAGCAATGACTGCCTTGTTCTTCATTGACGAGAAGAAATTGTGAATCTCCAGTCGATTTTCCGTGTCCATTTCGCTCAACTGGTTCATGGTGTTGGT
AAACCACGTGAGTGATTCCTGCTCGCGGGTGACCCAGTAGAAGTAAATCTTGCGCAGCTGGAAGCTTGGTGGAAACCGAACGTGTCTGCAGTGAGGGCAG
CGAAACGATTCCCACTGGTGCATGATACTTCGGAGGATTGAAACGAACGGAGTCACGCCGATGCCAGCCCCAATCAAAACAACCTCTCGGTAGCTTGAGT
AGTCTTGTGCGGGTGACCCGATCGGTCCATCGAGAAAGATCGCGGGGTACGGAGACGTCATCGGACTTCCTTGGTCTTCTGTTCGCGAGGCCTCGTGCTG
CGTGTGTAGTTGATCCAGTCGGTTGTACAAGGCACCCGTCCAGTCACCTGCTCGTTGGACATGAAGACTGAGGAACTTGTCTTCCGGCGCTGATGAAATC
GTGAATGGATGCCACTCAAACTTAGATATCGTAGGCACATTCACGTAGACGTACATGCCCGGCAGAAACCGTTGCCTCTTGCTGAAGgacttcggcttct
tcaTAAAGATCGCCACCGATTCCTTCGAAAGCTGCACCTGAGCGATCTTCGTCTGTCCACCGAACATTTGAGTCATCCGGTACCGCTTCTCGATCAAGAA
AATAACGACTGGCAGTAGAATCCAGTACTGGGCCAGCGGGGGAGCTACCCAGCGAGCGAAGCCGTGGAACGCCATCAAGACGAGGAACGGGATGAACAGC
ACGTGCGTTATCCAGAACAAGTTGAACTTCCCGCGACGAAACTTCTCGAGACACAACGGAGCCGCGATGGCAGCACAAATCAACATAGCAACCCCCGACC
AGATCGGAAGGCGAAGCGCGAAGAGAAACAAATTCTCGTCGCGGACGAAGGTGAGGTGGTGGTACCGAGACTCTTCCCACAGTGACAGATGAACCGTTCG
AACGTAGACCACGATGGCGAGCCAAGCTGCTGTGTGACCCAAAGATGCGATCAATAGCACCACACCGCAGATCTTGTGGAACTCGATGTGGTTGTCGATC
GGGAGGTAGTTTACCACAACCGGCAGTGTCCGAAGACCAGTCATGAAGTTCCGGCACATCGGCAGCAACACGAACATGGTGTTCACGAGGCAAATCTCGG
CAAACCCCTTGGCGATGCGAGGGCAATTTCCGACGGCAGAGTCGACTGGAAATCGTGAGGCCTTGGCGATGAAGACACCGATCATGAGCAGGAAGTAGAG
CGTGAGCCAGAAGATCTCGGGTTTGTACTTGCGGCAGAACTTCTTGACGCGGTACCA