Description :
From Genome Similarity Track
Location :
Scaffold_148:97087- 98321
Transcript NameFunction/comments
Phyin_T30-4PITG_20318Putative uncharacterized protein

Sequence
1234 bases(100 bases per row)
CGGACATGTTTGGCTACTATATGAAAGTCGAGATCCTTACTTGCCGCCATTCGATTGCGTTTTGCCGTGTGAATGAGCCCAAGCTCACTAAACAAGCGCT
CGCATGTGGCAGTTTTGACTGCGATTGAGAGCACTCTCATAGCGAGCTTCGGCAACAGGCTCGTTGGCTTTTCCAACCCAACGCCTTCCCAGTCCTCCAT
GGGTGGATCAAGGAAATCACTTGGCTTCATCCTTGTGAACCTTCTCTGCATCCATGCGAGCATGTCACGTCGAAGTTGGCCAATTTCATCGGTGCCAAAG
AGCCGTCTGTAGAAATAAGCAGCAATTTTGGCAAGAGTGCCGATTCCAGATACCACAGTCTCCGGTAGCTCTCTCGAACACTCCACGTATACAGGATGCA
AAGCAAACCAAAGCATAAATAAGGGTTGCTCGCACTGTTCCCAGCGATCTTCGACGCACTCTATCATTTTTTTGATGAACAAGGTGCTGCTGAAATCCCT
TGTAGATATCGCCAAATGAGCGAACTACGTCATCAACGGTGTCTTCGTCTCTTTATAGGCGATACGAAGCGAGAGATAGCGGTGCAAAAACCGCCTCTGC
TTCTCTGAGCTCATCCCAGAACGCCGGATCTCCAAGAACATGAAGCTGCGACGGAAAATCACTTGATCTCTTGTACTGACAATGAAACATCTGAAGCGCT
GACTGTACACGTAGTAGCGACGCGAAACACCCCTGCGTTGAATTCCATCTTGTTTCACACAATGTTCTCAACCCTAGCGGCTTTCCATAACATTTCTTCA
TCACCTTTCTCGCGCGTAGCAGCCGTTTTGACGAGGTGTTCAAGGTATTGACCGCAGTTGCAACTTTGGCAGGAGCACCACGAAACGAAGATCGCAGAAC
CGCTTTGACGAGAATTTTCACGGCATGTGCGAAGCAGAAGAGAAAAACAATTTGAGGCCACTGTAGCGACAATATACGACGTGCACGACCCCACTGTCCC
GCATTGTCGGTAATAATCGCTCCAGCCTTCCATTTCTCTTGCTGCGCTTGAAGTAACACTTGCACCAATTGGTCAGCAATAGCAATCCCGTGATGTCTAT
CACCAGCGTGTAAAAGGGCTTAAGTAAGAAGTACCTCAAATAGCGCGAGCTGGCAGCCTAACAAATGATCCTTTGAAGTATTCTGCCAGACATCGGAGAG
TAGATTAACCCATCCTTGTGCTCTTTCCTCCATT