Description :
From Genome Similarity Track
Location :
scaffold_45:97079- 98886
Transcript NameFunction/comments
Plaha_PHALS_10572hypothetical protein

Sequence
1807 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACTGCCCCGACGTCGTAGACGTTTATTATTTAAAGGATCACAACGCTTCACGTCATCGTGCACCcctc
gcttcttggcagtagcccgggacgccagagggccatgagccgagctcaaactatggccctgagctgctgtggccgTAGACTCATCCGTGAGGTACCACGA
GCTAGCGGGAGCGCGATGGGTGATTCGATGTCTTGCAGGGCTACCTTTCTATCATTTCAGTCATTATGAGTACTATGTTGTTTAACTtatgcagcggttt
cgccagagGCGAGCACGACAGGAATAGTCGGCATTGCGCGTTCAGGAGCGCTTCTTttatgagctcgaagtcgagcgcggtggcgatccattgggatttc
ttggggtaccaagaagcgagttcGAAGACCTtcccgctggtcaagctcaggttgtgtagtggccggggctccgactacgtagacgcctaacgatcaagtg
atcgcgtcttttgcttcagtagtaCTTTCGCCGACCGGAAACCGTATTATACTCGAGGATTTTgaaccgaacgtggatacgagcgcatcaGATCCACCCT
ATGAGTAGCCTTCAACTGTTGCTCCTATGCATTGTGGAGGCGATTGATAACAATACCACTCCCCCCGGAAGTCAAGAAGTCGGGGAACGggcacggtgtc
cgcaaggtttgagcaggcctcacgtcgcgccgttggcgctcCTCACCCTCCTCGTTTTCTCTTGCTAGGGAAGGAGTacccgactcgtagtcgactttct
ccgaatcctcgacgaggaaatccgtcccCCGAGTCGGGtgcggtgtgtggcgcttgGTTGCTGAGGGCTAGGGATATGCTTTCCGTCAAGCCGCATACGT
AGTGTCCGGGGATGCACCACGTGCAGAAGAAAAATAAGACTCTACCCGCAGGCGCcttcggaaccagctaggctgggtgttgtTCTCcttgtcatagaca
caaggctcattgagcggagaatttTCAAGAATGTTCTAAaggacgtaacggtgtctcagacacgcgagcctcgtatgaggcgactgttaaatgtgaactg
tGGGTAACACATtttatgggggagagtgtaacggggttatacgTACTTaagtatgaaagggcgggttaCAAAAGACAAAATGACTAAcctaggtgtggat
tacacaagttggtgtaaacacacaatggtgtggacaagaagccactacgtggcagaacTGCCAGTAGTGCTCTATATTTTTAAgtttaggaaaacctaaa
aaTTTTggtattggcggctctgccgcagctaTAACTATAAAATACGATTTAATCTTAAACAGAAGAATTAATCCGCCTTGCTAAAAGTTTATAAATACTC
TGTACAGAAGAATTTATTTGCCGTGGTAaaagttttaagtactcttggtagcggattgcgatccgctacactcgtactggtccttgtaaagaacgcaaGG
TCAGGGACCTTAGCCTAGCTTCTTCTGAGCAAAGAGATACGACAACCCGGCTGCACACAAGCTGTCTACATAAAAGTGGGATTGCCTTGCTCATTGCGTA
ATATAGGCGTGGATGACTCCACGTAATTGTTACAAATGAGTTTTGGAATCGAAAAGCAATGGAATATCTTCGATCATCCCATCGCGCACCCTTTGAAGTC
TACCGTACTCCCGCTCAGGGGTGCACAATCAGATTGGTGCTTGGGAACAAAAGGGAGCTCGGATATCGTGACGGTGCTTCGTTTTCGAAAGTGCATCCCG
CTTATGT