Description :
From Genome Similarity Track
Location :
Scaffold_5:97071- 98729
Transcript NameFunction/comments
Albla_Nc14007950

Sequence
1658 bases(100 bases per row)
GATGCTACATTCGAAATTTTGGACTCACCATTCAGCCCGATGCGATTCTCAGCTGCGAGTTTACGATTGATAGCATCAATGTAGGCAGTAGCCGATGAGA
CAAAAATGTCCGTATCCGCGCCATGACCAACGTATTGGCGAATTCGTGTCAGTCCGGTTTGCGGATTCATTAATCCCTGCGAATCGATGCTGCCATCATC
TTCGCTATGTGTTTCTTCTTGAACTCGAACCGTCACTTCACCTAGCGCACAGGTACCATCAGTGATACTATTCACTGAGTATTCATTGAGCTGGAGTTTG
TTGGTCCTAGTGGCTCGCTGGATAGCAACACATATAGCGTCTATAGGTCCGATGCCCATCGCTGCTTCGCTGACTTCTTTACCATCTCTACTGACCAATG
TAACAGTGGCGGTTGGCTTGACACGATTCCCAGCTGTGACATGGACCAATTGAAGGGTCCAATATGCCTCAGATTTGTACAGTTCATCCGATAAAATCGC
GTCGATGTCTGCATCTGTGATTGACTTCTTTTCATCTGCAAGCTTCTTGAACTTGGCCACATAATGGGCAAGCTGTTCGGCTGTCAGATCTGTGTAGCCT
AGTTGTTGCAAACGCTTGCTGTACGCATGACGACCAGAGTGTTTTCCAAGGACCATCTTGCTTTCATTTAAGCCTACCGATTCTGGGCACATGATTTCAT
ACGTCGCTTGATGCTTTAGAACTCCATCTTGATGAATACCGGATTCATGTGCAAACGCATTTGCACCAACGATAGCTTTGTTTGCTTGAATGTGCATACC
CGTGTAGTGACTGACCATACGACTGCATCGAGTGATGTGCGTGGAATCAATATCACTGTAAACTGGGCAATGTTGTGGGCGTGTTTGCAAAGTCATAATC
AGTTCTTCAAGTGCTGTGTTCCCTGCTCTTTCGCCAATACCATTCACTGTCACCTCTGCCTGACGAGCACCAGCACATACTCCAGCAAGAGTATTAGCAG
TTGCAAGTCCAAGGTCATTATGACAGTGAGTCGAAAATATGGCTGCCTCACTTCCTTTAGTGTTCTTGATCAAGTAACGAATTAAGGATCCGTATTCGTC
AGGAACGGTATACCCCACAGTATCAGGAATATTAAGGGTTTTTGCTCCAGCCTTGATGACTTGCGCAAGGACTTCACACAAAAAGTCGGGATCCGTGCGA
CCGGCATCTTCTGTCGAGAATTCCACATCATCACAAAGACTCGAAGCGAAGGAAACCGCTTCAACAGCTCGGCGTATACACTCGTCACGACTTATCTTGA
GTTTGTGCACTAAATGAATGTCCGATGTCGCCAAGAAAGTATGAATTCGGTGACGTGGAGCATGTTTCACAGCGTCATAGCAACGTTGAATGTCTTTTTC
CATTGCACGCGCAAGCCCACAAATGACCATGGGTACTTCTGACTTTCGATTGAACGTCAAGGGCCCAATCTCTTTAGCGATCGCTTCAACCGCATCAAAA
TCGCCAGGAGATGAGATTGGAAAGCCAGCCTCGCATACATCTACACCCAGATGGGAGAGTGAGCGAGCGATATCGAGCTTTTCCTTGAAATTGAGTGTAG
CTCCAGGTGATTGTTCGCCATCGCGAAGGGTTGTATCAAAGATAATCAGCTTGTCTTT