Description :
From Genome Similarity Track
Location :
Scaffold_30:97056- 104432
Transcript NameFunction/comments
g9678.t1hypothetical protein

Sequence
7376 bases(100 bases per row)
TATTCGACGCGGCTGAACTCCGTGGTGTTGGTGCTCGGGCGGTAAAACACGAACGAGAAGTCTGCATGGAACGGACCCGGGTGGAAGACGCCCACGGACG
AATAGCCGAGCTGGTATTGCTCAGTCGAGTCTCCAAGGATAAGCACATCCGGGGTCGGGAAGAGTTGCAGCGACGAGTCGAAGTCCCAGTTGATCGGGTT
CGCCATTAGCGGCAGTGGACACAAATGCGCCTGGTCGATGAGCGTTTTGGCCAACTGGAATCACGCACCACAAGGCAGCAACAATGTCAACGACTGCACG
AAGAACACTTTCAATCACGCAAACACTGCACCGTACATGCTTGGAGATATCCGTTTGGGAGACGGACTGACCGGCCTCGTCACTTTCATCCATGGCCGCT
TCCTCATGCTCACTCGGCATTGGCGGCAGAATGGCATGTCGCTGCATTTTTTGCTGGAGGTCATCGCGGAAGATGACGATGTCTTGTGTGTAGTAGCGGA
TTCGACACGGGTTGGTGCTGCACATGACATTTGGCACCTTTCGCACGAGCTCGCGTGTACACAAATCAGGGAGCTGCTCACAACTCCAAACGTTAGCATT
CGTTAACGATTGATAGACAAGTTTGCTGTTGCCTACCGGGTGGCGTGGGAAGGCGCGAGACGAGCCCGGGTCGTTAGGCCCCGGCACCAGGACGAAGCGC
GAGTTCTCCGCGATGCCAGGGTACTTCAGGATGAGGTTTCCCAGATCTTCCAAGTATTCCCGCAGGTCTTGCAACGAGTTGGACCCGGCACCTCCGCCGA
TAGATGTGGACATGAAATCACCCATTAGAATGAACAACGTCGGCTGAACGCTTTCGAGTCCCTGGAAAAGTTCGTCCAGTTTGCTCATGACCTGTGGGTC
GTCCAGGTGCACATCCGACAACACGATGAATGTAGCATGGTGGTCGCTAGCTTCTAATGTTCGGATCTGTTCCCGCTGTTGAGCCGATACCTCCACACCA
AGAGGGTCGATGCCACCCAGAACCTCCAGAGACGTCTCCTTTGTCTCTGGCGGTGGGAACCCCATTGACTAAAAACAAAAACAGCACCCCACCACCACCA
TTATTCAGCACCATGTCCTTGCAAAACTTTCAGCAGCAAAATTCTTACCTGGACATGAAGCACGTCATCGATCACTTCTCCTTCCACCAACACCACACAG
TTGATTGTGAAGAGGCCGTCAGTGTACACTGCATTCGTAAGATCGATGATAATCCGCGACGTGAAGTCTTCCAGGTACATCCTATTGCGTTCATCCTGAC
CCAGCATGCCAATCACGCGTCGCAAACCCGTCATACCCAGCAGCGACTCAATCCGCGATAACTACACAACACCAACCAACTAAGCTCTCAATCCCCGCCA
CACCGCAACTTGTCCAGCAATGAAATATTCTCTCTACCTCCATGTACTCTGTGGTGTTGGCCAAAGCGGCCGACGGGGGTGCAAAGAGTCGATTTCGCTT
GACACGGAGATCCACCGACATGAATCGATCTCTCAGCAGCTGAATCCGCGACTCAGGACCCGCATGGAGTCGCCGGTGGGCGTCTGCTTTCAGCTCGTAC
GAGTTGTTGTGCGTGTTGAAGTGCAGCCTCGGCGTGTCGAACGCCCCGAACACCTGGATTTGTTCGAAGTCGTTCTCAGCCGAGACGGCCAAGAGCGTGT
CCAAGGCGCTCTCCAGAGCCCCCAGCGTCACCACAGACGTCGTCACTATACATCATCAAATTTAGTCATCTACAGTGCTTTAGAGAACCTTTCAGGCTGA
AAACGCACTCTTGCTACGGTCGATGTTGTTCTTGATCGCGTAAATGACATCCTCCAGCTGTAGGGACGACTCACTGCACACGGAAGGCGAGACATTGAGC
GTTAAATTAAGAAGGAGTGGACGGCTTCACTGTATTAGTTGGACGCTACTACTGAGCGGTTAGTGGTGAAAATTAAATGAGCAGACGTGCAAGACGAATA
CGCACTTGGCCAGCTCGTCGGTGAGTCGTCGCAGCGCGTCGGCATGCAGCGACAACCCCTGCAACTTACACGCGCGCAAAACCCGCTTGGATGCCATAAT
TTTGAGTGGAAACGGCGCCAAAAGGCAGTGAGGTGGTACAGTGTGCCATACATGGATACAAACAGTGCGTTGAAGTTGCAGTAGTATTAAGTCTATGCGG
CCAGGACAGAGCTTCTAAGCACAAATCTGTTGACTCTGGCAATCAAAAAGCTGGAGAATTCCTCCAATTTGAACGCGGGTCATCGACTAGTAGGTCTGGT
TGCCGCCTTGGCCCAGGCCCAGCACGTAGCTCATGCCCTGTGCGTCACGCACAGCAGACGAGTCGCCCATGGCTGCAGACACCCGCGAGTAAGTGTTCCA
GCACTGCGCACTCTGCGGTCTCGCGCTCAGCCTACAGTGCAAATGCAACAGAACGGACATATTAGGAGGGCGGGTAGAGGAATAGCATAACATTTTCTTC
GGCCGCATACCTTTCGTTGAGGAGAAGTTTGGCGAGACGCAGATCGTCGCACTTGCTAGCACTGTGTCCCACAAAAGCTCAACATATTAGCTAACAAAGG
CCACGGTTTTTAGGACAGAGATATCCGTACCATTCTATGAGGAGCTGCTCCACAATATCTTGGTCTACGTCAGTTCCGCCAAGGAGGCTAAGCTTTCCAC
GTGCTGGAAGCAATGCTTGGGTAGCATCGTTGAATCGCGCCTAATCATTTTAGAATTCAAGACGAAGTTGGTGAGGCGTGCATTTAGGTAAACAGAACAG
GATGCGAGCAAACACAAGTGACTTCACAAACCTCAGCGTACGCTTGGAAACCCTTGCAAACACTGCTGTACACCTCCTCTAGCTCGCCTGACAGCACCAT
AGTTTGTAAGCATTTTCACGCATCTGGGTGCTCACCATTCCAACAAGAGCAGATAACAATACCGGGGGAAGACGAAAAGCTAAACTGGAACGGAGTCGTG
CCAAGAGAGGCTTCCAAGCGGCCAGTATCGACGGCGGGATCAGTGACCAAGGGTTCCGGAGAGGGGGTAGCGCCGGACGGCACACACGACAAGATGCTCT
GCGTGAGTATCAAGGAAATCGTTAGATGAGAGCAAGGGGATCGCCGCCACAGCAGGTACTTACGTATCGTAGCACGCTCGCAAGAGGGTGGAGGCGGGAT
GTTGACACCGCATTTGTGTTTGTGCTTGAAGGCGGTTGTACGGCAGACCAGTTTTGGAGGAGGTACTCGCCTAGCTCTGTGTTGTCCTGGCCTGCAAAAC
GCAATCTCCAGTAGAGCTGCGTCGCGTCACACAGCGTTGGCACGGCGTGGGGTGCACCGTCGGGCTGGTAAGGTAGGATATTCACCTCCAGCATCTTGTT
GATGCGGTCATAGTTACCCAAATCCATCATGTACAATGCCCACTGAAAGTAAAGGTGACGCTCCAACGGCCCCCCATTGTCAAAACCTGCCTTGAATTGG
TTCGCATAGCTCGCTCCATGGTTTGCGTTGCCACGCGCTTCTAGGACGTGCAGCATGGTGTGCACTACAGTAGCGTCACAATATTCTGCGTCAGTCTAAA
GCCAATCAAAGACAAATCCGCCTCCACTTACATGCCCAGCGATCGTTTCCATTCATGGATAGCGACTTCTCCGCCATAGCTTCAGCGGCGTCCAGTCGGC
CGGCCGCTTGCATTCCATACGCCTGCATGGCCAGTAAATGGCTGTATGCAGCGTCATTAGGTGACCAAGAAGGCAAACGGCGCGTCACCGTAGCCAACAT
GTTCTTGTAGTCACTGCGACAGCATCCACCCCGTCAATCCCCCCGAATGCAACCTCCGTTCAGCATCAACGTTCCAGCTCACCCCAAGAACTTGTAAATA
TCATAGCAACAGCGCAGCGCCAGTAGGTCCGAGTGATCATGCAGCAAGATGGTCTCGTAGACCGTAGCAGCTTCGTGATGGCGGCCGTGCACCATCGCAT
CCAGCGCCAGCACGTGCATCTTCTCGCTCGTCGTCGTCTCCTCTGCAAGTGCAATTGCAAAACAACCCAGCACTTGAGTCTCTGCACCTCATTTCTAAAT
CTCTCTGTACTCCCCACCTCCTTTAGCGATTGTTGCCGCCGTGTCCAATCTGTCGGCAGCATCCAGCGCGTCCTGGTGCATGAGCGGGGCGAGACACTGG
CTGGCGCCCACCAGCACGTGGCCCATTAGAAACGGCGCGTCCTCCTCGGCCAGCAGCTGCTGCAGCATGAACTTGGGGTGCGAGTTCATGCTCACGTACT
ACAGAACTCGGTTAGAAACACGGTTAGAAAAGCCAGCAGTGTGCTGCCACGTACGTCCAGCAGCGCCAGGTCGTACGCCTGCTGCTTGCTCGTGCTGCGA
CTGAGCGACGTGTTGCGCGCGCCCTCAAACTCGCCGATGCCGAAGATCGAGCCCAGCAGCGACATGGCGCGCGTCGAGCGGCCGCGCAGCAGCGGAACTC
CTCCGCGCCGCAACATCCTGGGCGAGTCAAAAAAAGTAGTATGGCGCTGTCATTTCGGTACGTGTACCTTGCATCGAAATGATGGCACCCGATGTGAAAA
GGCATGAAAGTTTCCTTTTCACTTTCTGACATCCTACATGTACACGTCTCCAATGCTCTATGCAGAAGGAGGAGGTGCACTCACTTCAAGTCCGATGACG
AACGGAAGGAGGAGGACGCTTTGTATGACGATATTAGTGACAAACAGTTTTTTCACCCTTGCATTTTCATTTTATGACTGCATTTCGGTTTTCAGGACGC
TACGAACCACACTTTCTCACAACTACGGGCGCTTTCTTTCGCGCCGATCACTTTAACATTGAGCACGTCGGATGGACAGACTGGACGGACATCCTCACAT
CATGTGCATGTTGGACCAGGACTGCATGTCGCCGCCGTGGGGGACGTTGCCTTGGCTGATGGGTGCGGCAGCACCGGTGTTCGTCTCGGAAGCAGACATG
TTCTCCAGAAGGTCGTCCCAAGGAGCTGCCTGCCCCACGCCACTGCCGGCGTGATATGCTTCACCGGCCCGTGGGTAGCCTGGCGTGGTGATTCCACTTC
TCTCGTGGTCGTGGCTGGCGAGGCCCGGTAGCATCTGCTGCTGCTGCTGCTGTTGTTGATGCTGCATCACGTTGGCAAACCCCATTGCTGGTTTTTCTGC
CTTGACGTCCGAGTACGGCGAGCTGGACGGACGCAAGAATGGCTCGGGCTGATATTGCTGGTGCTGAGATTGGTGCTGGCTGTAATCAAATGGGCCTGTC
GACGATGCTGGAGGGGAGAGGCGTCCGTATTGTGGGTACGCCGCAGATTGGTCCATTGGCAATCCGAAGCGACCGACCTCCACGTTCGCCTCGGGCGTGC
GCATCTTCTTCGTAGGGCGCATTAGCTGCTCTGGTTGCTGCAGCAATGCTGGAATAGACGGTCCAGTTTCCTGCTGCCCCAGCACCGAAGACGAATACAC
GGCCGCTCCAGTGCTCCACGACGACGACACATTCGTGTCGCTCGCCGTCACCGCAAGCACGGGCGGCATGGGGGTGATGCTGGCGGTGTTGGCCGGCGAC
GGGTGGTGATTCCACGCCAGCAGATCATCGTACTGTCCGTTGCGGAGAAGCTGCATCGCGCGCTTGCGCTTCTTGGCATCGGAGACGTCGAGCCCCATCA
CGGGCTGCCCGATTAGCACCGAGAACTTCAGAAAATTGTTGACCCAGAACTGCTGGACGGCCAATCGAAGGTGCTGAGTCTCCACGAGCGCGCCTTCGTC
CGTGTTGTTTTCGCGGCGGAACTGGTCCACCAGCTCCTGTCTGAAAATCTGCTCCAATCGAGACAACTCGCGCTGTCTCCGCGCGTGGTCCATTGAGTCG
AATTGCATGGCCTTCTCGCCCTTGCCAGGCTTGGTCACTCGAAACGTCCTCTTGCCCAGAGCATTCTTCTGGAACTTTTTGGACAACCTCATGGTTGAAC
AATTGAGCATCTTAGCGAGCACCAGCCGAATGGGCGTGCCGTGCGCTAGAGGCAACGCTTGTCGGTCGAACTCGCACAGAATGCCGTCGATGAATTTCTC
CTCAGGTCGAGTCCACTTCCCGCTGCGTGGCTCGGGCTGTACCATCATGTTGATGCTCGGGGAGATGGCTACCTGGTCGAGCGGCACCGCGCAGGCCGGG
CATGCGTCCAGCGGCCACACGTGAACGCAGCGCGAGTGAAAGGTGTGATTACAGTTAGGAGATACGAGAACAGGGTCGGGGTATTGACAGACATCACACA
TGCGCTCCATGGGCATCGGAGGCTCTGCGTGGGTCTCCGGCGCGGCCTGGAGGCGGTAATCTGACTGCTGCTGATAGGCCGCGATGGGCTTGTGCTCCAT
TGGGGACTCGGCGTACGGGAACTGGGAGATGGCGACGGGCGTGCGGCTCGGCTGGTAGTACGTCTGCTGCGGTGTGTACTGCTGCGGCAGCGGCGACGGC
TGGTAGTACGTCGGGGCCTCGAGCGTCGGCCGCATGCTCGGGACCACCGGGCGGTCTCCGGTGATGCCGGCGCCGTGCTGATGACTGTACTGCTGGCTGT
ACTCGTAGTCGTATTCGGGCTGGTGGTGGCCCCCTCCACTTGGCTGCATTCTTGAATTCTTGAAGACTGGCTCAAAGACTGGTGCTCGGGCCTCACAAAT
CATGAAGCGAGGGGGATCAAGCACTTTACTGGTCACTCACTCACTAGACTGAGTCCGCCGAGGTGAGCGGAGCTTTCGAGTAGTAATGGATGAATTCGCA
AGTGAGACTCAAGTCCTTGGCGAGAGGAGGGGGAGGAGCGCGGTTGGCTGGCTCAATTCGGCAGTGGCAGTATCAGGCGATACAGTACAGTAGACACCAC
ACACAGAACGAGAAGGTCCAGGACCAACTCCGTTTCTGTCTTGCCTTGCGCTTCCTTTCCCCTTCTGGCGTTGGCTCTCGGCAGTGGAGTTTCCTGGGCT
GGCGGGGTTAAGGAGAAGCCGCACAATCGCGACCGAAGGCGAGGGCGATTTGCTGATGCCGCCGATTGTTGTGACGACGGCGCTCGGCGAAAGTGCGCCT
TGTTGCTGTTTCCTCGAGACCCGGTGCTGCCACGTCCCACTCGGCAGCGGCTGTTGCAAAGTGGCTGTCCTCGCGGAAGCGCCCGTGTATGGGTCACGTG
CGTTGACTAAAGCGCAGGGCTCCCTTGCCAAAGGCCTTGGGCCTTGTTCGAAGACGGTGAGATGCCACGTTGGACGAGCCGGAGCCGGGCGACTCCCCGG
GTCGGTGCAGCGCGCGTATTGAAGCGATGGGTAGCACCCGGTCGGACTCAATCAAGCGGGACGAAAAGGACTGGCA