Description :
From Genome Similarity Track
Location :
Scaffold_84:97052- 104514
Transcript NameFunction/comments
Phyci_95134Hypothetical protein
Phyci_83209sialinlike protein putative
Phyci_316865Hypothetical protein

Sequence
7462 bases(100 bases per row)
AGCAAGGAGCACAACGCGGCGGGAGAAGACTTGCTTCGTGTGGGACAGCTGAACCTGGTGGATCTTGCTGGATCCGAGTGTGTGGGCCGATCAGGGGCAC
GCAATGCCAGAGCGAGGGAAGCGGGCACTATTAACCAGAGTTTGCTGACGCTGGGACGCGTGATCACGGCCTTGGTGGACAACCTTCCGCACGTACCATA
TCGTGATAGTAAGTTGACGCGTTTACTGCAGGAGTCACTTGGCGGGCGAGCAAAGACGACGATTATTGCGACGCTGGCCCCATGTGCGGATAGCCTGGAT
GAGACTCTCAGTACGCTGGAGTATGCATTCCGAGCCAAGCATATCAAGAATAAGCCCGAGCTGAACCAGAAAATGACCAAGGCTGGATTGTTGAATGATT
TTGGAAGCGAAATCGAGAGCCTTCGCGCGGCCCTGCGTGCTGCTAGACTGAAAGACGGCGTTTATCTCCCGCTGGAGCAGTTTACTGATATGCAAGAGCG
ATTGACAGGCCAAGGCGTTCAACTAAATGAGCTAGAAGATATGCTCAAGGCAAGAAATACTTCTTGTAAAGAGCTCGAAGAGGCTGCTGAAAAGCATGCG
AGCGAGGTAGCTGCATTGACATTGGAAAAACAAGAGGTGAGCAATAAGTTAATTGCTACGGAAGGCGAGCTTACCGCTACCAAGAACACGCTAGAAAAGA
CAACGCAGGAACTTCAACAAGCAAAGGCAATGCTGAATGCCTATCAGGAGAACGAGCGGATGCTACTCGACAATGGAACTACTGCAACGAAGTTATACAC
AGACAGCGAAAAACGGGCCGCCCAGCTAGTGGCAAAGATTGGTACGTAAACTATTGCTTCTTCTGGCTTTACTGCTGATGCTTAATTTATTTGTTGTATT
CGCAGAGAACACCCAGCGAACAGAAGATGAGAACGCGGCACTGGCGTCTTCCTATCGTAGTGAGTCACAGTCGCAGATTAACAAGTTCCTCGAGCGCCTG
ATGAAGCACAAGACAAGCCAGGAAGAGATGTTTCAGGATGTGTCCAACGCTTTGCAAGAGTTGCAGACAACTCACGCAACAGATCTGGATGGTTTGGTAA
CAAGTCTGAATGCAATGCAAGGTCTCGTCGAAGCGCGGAGAGCTCAGGTTACTGAATCCCTCGCTGAAGGCGATACCCTAAAGCGTAACCAGCGTGATGA
AGTGATGGCAACAGTTAAAGTGCAGCAGGAAACTATGGAGGAACAGTTCGAGAACCTAATTGAAATGTCCAAGAATCACGCAACGGCTATCGTGGAAGAT
CTCGCTACGTCTAAAGCCCGAAATGTGGCATTCCTGGAGAATGTGCAGTTGGCGGTGGAAACCTCTCGAGAGGAATTGAGAAGCTTCTTGATCGAGCAGA
GCGATAAACTGCTAGAATTACAGGTAGCAATCGACATGTCGATTGAAAAGCAGGCCAAGGAGCTTGACGAAAACAAAACTGCACTTACCGCAGCTCTGAA
GGACAGTCATGCTCAACAACAAGAGGAGCTGGCCGGGATGAAGACACACCTTGCTCAGCTCATCGAGAAGTGCATTCAGAGCCAGACACAAAACTTTGAT
GCGCAAACTAAGCTTATTGAAGAGAATGTGAGAAGTCAGCAGAAGCAGCTCTCGCACGTGCAGAGTATTACAGAACAAGAAATGAAGGCCTTTGTCCAGA
CCATAGGCAGCCAGAATTCGAAGCACGAAAGCGAGACGGCTGGACTTCGCGAGCGCTTGTCCGACATGCGAGGTCAACTTGGCGACGCCAACGTGCGGCA
AATGGATCTGGCTCAGTCGCACGAGCGGCTGCAAACGACGTGGAGCAACGACGGTGCTGCGCTGGCAAAATCGCACGTGCAGGATATAACTACACTGGTG
GAGAGGCATTCGCAAGCAGACGCCGAGATATCAACGAAGAAACGGGAGCAGTTGGCGCACTTCCTGGGTGATCACGAGGATCTCCGGCAGCTTCTGAAGG
GCGGATGTAAGGCCCTGCAAAAGGGGCTTGAAGTCCACCTTTCTAGTACTAGGGGAAAGATCGATTCAGCATCAGTGCTTGACAAGGAGATAATTGGCAC
AGCTACAGAGGCGTCCAACCAGCAATTCCAAGCGATGGAGGAGTACATGAAAAAGAGACGGGTAAGACGCAGTCGGTGCTGTTACCTTAAACTATGGACT
AACTGGTGTTGACCTGTCGTTTATTGTCTAGATCAATACACGGACGGGGGCGACACCGATGAAGAAGGATGGCCGGCCCTTTCCAACGTTTGAGGCCACG
AAGGTTTCTGCCGAGCAGATGAAGTCTATCGAGAATTTTTCCAGCTTCATGTCGAGCACCGAAACTCTAGCTGGGAGGAAGCGAAGGAGGCAAAGCGATG
CAAGTCCCAGTGCCGTTGATGATGTGACGCCTGCCGCGAAAGATATCTCCAAGCAAACGCAAAGCGATGCCGTCGTCAGCGCGGAGATCAGCTCAATATC
AAACAGTCAGGATTCTAGGAACCCTGACCCGATATCAGCAACCGAGTCAAGTACAACTGGAAAGGCCCCGGGACCTCCACCTGAGACCAAGTCCGCTGCA
ACAGTCAACACTACGCCAATTAAGACCAAGGTTGCTGCAGTCAAAACTACGCCGTCCAAGGCTAAGCCTGCCACCGTCAACGCGACACCATCCAAGACCA
AGCCTGTTACAGTCAACACCACGCCGTCCAAGCTTAAGAGGACTGGATCGTCTGCGCCGCACAAGAAGAAGCTGGCAGCGCAACCGCACAAGAGCATGAA
GGTTCCTAGTGCAGGCGTAGCAGCTCGCAAAACCGCCAAGGCTTCAGCTCTCGCGGCACCGAAGCGGTACCGCGCCAAGTCGCCGCTAGGGGAGACCACG
AACTTACGTTAGTCCTGTAAGGTTATCTGCTCGAAGCGAGTGTGTCAATTTATCTGTTGAAGCGATCCCCTGCATTGCGCTCAATCAACGATGCATCATG
CATCATGCATGACATGAAGCGCTGCACAGTGACGCAGGTTGAAGTGGTGTGATTGGCTGAAACCCTTGATGAGTGTACCAGTAAAACGCCGTTACAACGG
TCGCGATCCGCTCATTTGCAAATTGCAATGGGGAGCACGAGCAAGGAGGCGTGGAAGAGGACTGGCATCGCCACCGCTGCGGGCGACGTCTCCGCCACGC
TGCCGAAGGGCAAGCGGCGCTATGTGACTGCCTTCCTGTGTCTTTGCGTCTCCACCATCTGCTACGCCGACAGTATGTGTATCTGAGTGTCGGGCCTTCG
CTGCAAATGACCAACTTTTGGACTGTGGTTTGATGCGCAGGAACCAACATGGGCATCGCGTTGCCGGCATTCGTGACCAACAAGAAGGACCAGGGAGAGG
TGCTCTCCGCCTTCTTCTACGGCTACATGTGCACCCAGGTACAGCAGCGTAGTCGTTTATTAACATCATCAATTGTCAGCTTCTACAGCAGTAGCGTCGT
TTGTTTTTTAACATCATCAAATGTCTGCTGCAGATCCCGGGAGGTTACTTCGCGGCCAGGTTCGGTGCCAAGGTCGTGCTGCTGACTGGGGTTGTTGTCT
GGACGTTATTTGTATGTAGCCATATGGGCTTTATGATCTTTTGTGCCTTAATTGATGCCATCAGTTCTGATAGTTGCTTGTGTGTGTATGATTGCAGGAC
ATCTCTACTGTGGTAGTGGCCAAATGCCTTACGTGTCTGTTTTTCACGAGAGCAGGCATGGGGCTTGGAGAGGGCATACTGTTTCCGTGCATGCATCAAA
TTGCCGGTGCGTGGTATCCAGTCCAGGAACGGAGTCGGCTTGTATCGCTGGTGGCAAGCGGCTCAGACCTGGGCACTATCTCTGCGCTGTTGATTTCACC
CGCCATCATGGCAGCAAGCGGTTGGCAGCGTATCTTCCTTGTGTTTGGCGTGCTCAGTTTTATTTGGGTCGTGGCGTATTCGATCATGGGAGTGAGTCGA
CCCGAGGAGGACCCGAAAATCACCACAGAAGAGCGCAGCTTCATCATTCGCAATCGCACGGTCGATCCTGACACTCACCGGCGTCAAAGCTCGCGCGCTG
AATTGGACACCCACGCCATGAATTGGCGCGTTCTACTGGCTTCGCGGCCTGCGTGGGCGATCTATGTGGCGCACATGTGCTACAACTACAGTTGGTACAT
ACTGTTGGGATGGATCCCGCAGTACTTCAACCAAGTGCTGGATCTTGACTTGGCCAAGAAGGGTGGGTTTGCCGCTGCATTGCCCTACATGTGTGGCTAC
ACTGGCACACTACTGTTCGGGCGTCTGGGAGATCTGTTGGTCACCCGCGGGTATCGTGAGTTGCACGTTCGTCAGGCTATGAACGCATTTTCATTCCTCG
GATGCGCCTTCTTCCTCTTTTCGCTGCGCTTGGCGAAGTCAGCACCTATGGCGGTAGCCCTGCTGTGCCTGACACTATTCACAAGTCGCGCCGCTATGGC
TGGCTACTGGGTCAACATGATCGACGTGGCGCCAAATCACGCTGCACATGTGATGGGAGTCTCCAACACCTTTGGAACCATTCCGGGCATTATTGGCAAC
GTCGTCACTGGAGCCATTCTTCAAGCTACGGGGTCTTGGGACCTCGTGTTTGCTATCGCTGCGCTGGTCCTCTTGTTTGGTGCGGCTTTCTTCCACTGCT
ACGCGTCAGACAAATCTATCTACATGGACGCACAATCCAGTAGCAGCAGCAACGGAGAAGATTACAGCAGTGCCAGCACAACTTCCAGCAGCTTCCCTGG
CAGCCCCAACTACACTTTGTCTCTTTCATCTTCGATCCCAGGGCTGCGTGATGAAGAGGAGAGCCTGCTTGAGAACCAAATGTAAGGACATGTACCGTAT
GTACACTCAAAGCGGAGGCTTCAACATTTAATGGTCGTTTTGGCGCATCCTGTACCGACCCAATGCTATCTTCTGGAGCTGCTGGTGCGATATTTCTTCA
CTCGGACAATTATTTTGCATCTCGACGAACAGATCGGTGGCCGCTACCCAGTTTTCACGCTGCTCCTCTGCGAAGATTCGTTGAATGTAGCTCTCTGCAT
CTGGGAAAACGCGGTAGGCACTGGCATCCTGCATAGTAGCGAATATTTGTGCTACGAGCTGGTGTTCCCCTGCATGGTTGCACATCTGCATGACTCGATT
AAACACAGCTACGCTGGGTGGAATACCAAGCAATGCTTGCATATCGGGAAGCATCCGAACTGCTCGGCGCCATTCGCCGACTTCTTCGAGCGAGTCTAAC
AACTGGGTCACAACAAAAACTGGTGGAGTTTGGCCGGTTTCGGTGTGCCACTTGTGAAGTAGTGTCGGAACCTCAACTACTCGGTCTCTGTTCTCCAGTG
ATGCGCACGCCACAAGGTACGCTGCAAAGCTTGAGTCGCTCACCAGATCACTTCTCAACCCAACAGAGTTCTTGCCTCGCTTGCGATCGATGAGTGTGTC
AAATATGGTAATGACGCCCTCAACGTCCTCGTTTACACTGCACGCAGCTATTGCACGTTCATACGTCGTCATATCAGGCTTCAATCGTTTTTGCTGCATA
TCCTCCAGAATCTCAAGAATGCTAGCACGAGCCCATGCAGCTTTCTCACGCTGTTCACGCTCATAGTCTTGGGGTAGCGTTGCACCCACAGTTAAATCTT
CAGCTGTCCGCACAATATCCTCACTCTCGTCTTCAACACCATGAAGCTCGTTGTTTTTAGGTtcatcgtcatccacatcatcgtcatcctcatcctcatc
atcctcatcctcatcaccgtcTACGCCATCTTCTCCTTCCCAGTTAATTTTGTTCTTTCTCCACCATGCGGCTCGCTCTCCAGCTTTAACGAAAGCTTCT
AATGCCGTATTATAGGAAATGATGTCGGCTGTCACACCATGTTTGCGCCGAATCACTTCTAGTACTTCCAGCGCACGCCCAGGGAGTCCAGCCTCTGCAC
AAGCGAGCAGAATGCGATTGTAGATACTAACTGAGACCCTTCCAAGCTTTTCTTCCATCTCGTTTGCGATATCCCACGCACTAGTCACATTTCCAACGCG
AGCATATGCGAACACCAACGGCTCATACGTCTCTATTGTCGGACTAAATGCTCGCGATGTTTCAATTGCACGAAATAGCTCCAACGCTCCATCCGGGTTC
TTTGAATTTGCGCACAGTTGCATGGCCCCACTAAGCACCTTCAGAGTGGGCTTGTAGCCGTCAACAGTCATGATGTGATCCAAAAATTTTAAGCCCACTT
CAAATTGCTGCTGGCTTGCGCAGGTCGCAAACATCAGCCCCAAAGTCGTATCATCCGGTTGAATTCCACGTTTCTTCATCAAGTTAAATAAGGCAAAAGA
TTCATCCACCTCGCCGAGCTGATGATAATAAGCAAACGCATTGTTAAACACACCGATGTCAAGTGAATTCACAGGCACATCACGGCAGGTACTGGCGATA
AACCCCGTCATCCATGTCAACATCTCCACTTCTTCTGCGACGATAGATTCGTCGCCCTCCTCGTCGTCGCAAAACAGATCGTCATCAACATCGGTATTGC
TACTCTCTGGTTTCTCCAAAAACGTGGTAAACAACCGGAAGAGCGAATAATATGTCCCAGCTCCTGGGTCGATCTTTTGGCCGTCGGTGCACCATTCAAA
AAACGAGAGGCCTTGCAGGACATTATTGACACGAGCACTGGAGTTCCTGCCACCAATATTCTTTAAGCTTGCGATGTGCGCCTTAAGCACCGTATTCATA
GTCACTAGGTCGGGTAGTAAACCAGTCTCGATCAGCTCGTTCACGATTGATTCTATTTGGCGAACATCACCGCGGAATGCACAGGCATTCAACAACGCAT
TATAACTCCACGTCGTCGGTGTACACTCCGGAAATGACACCGCATATTTTTTCATTTTTGCGAGCACGGATACTGCTTCAGTTAGTCTTCCGAGTCTCCC
ACAAGCACCTAACACGGCATTGAACTCTGCAGCACTTGCAGTTTCGGTTAGAATCAACTCGTCCAGTACATGCAGTTTGCCCTCCAATGTCAAAGAAAGC
CTTGCAATGGCTCGATCCGCCTTTAAGGCAGTAGTACGCAGCTGCATTCGCTCCAACGAGCGCTCTACACTTTCTTTCTGGCTCCGACTCAGCAGAAACG
CTTCCTGGTCTGCTCGTTTCATCCGAGACCAGTCACGATGGCCGAGAGCCCATGCTACTGCCTTGGATAAAGCGTCGCGCTTCGAAATCAATCCTTCCAA
CATTGCGGTATCGTTCTTATCGCTATCACTAGCAGTGCTCGGTTGGCTTCGTCTTGCAAGGGACAACGTGTACTCTGCTAAAGTCCACTCACCCCGCTGA
CGACTAGCATCAACCACCGCATTTACCACCTGCCGCCGCACAGGCAATGCTATAGATTCTTC