Description :
From Genome Similarity Track
Location :
Scaffold_43:97027- 98752
Transcript NameFunction/comments
g2048.t1hypothetical protein

Sequence
1725 bases(100 bases per row)
CCATGCACCCTCAGCTGGAAGAAGCTCAGCTACACGGTTGAGGTCAAGAAGACGGAGCGATGCCCCGACGGGAAGAAGACCATCCTGAGCAACGTCTCTG
GTCGATGTGCGCCCGGTGAACTCACCGCCGTCATGGGACCGTCCGGGTGCGGCAAGACCACGCTGCTCGACATCCTCGCGGACCGGGTCAGGTCTGGCAG
CATCCAGGGAGAGATCGCTCTCAATGGCGAACCCCGCAACGTCAAGACGTTCCGGGGCGTCACTAGCTACGTGGCTCAGGACGATTCGCTGCTCGGGTCG
TTCACGGTGCTGGAGACGTTGGAGATGGCGGCAAAGCTCAGTCTGCCCAACTCCGTCACGCACCAAGAGATCGTCACACGAGTGCAGGCGGTCATTGACG
AGATGGGGCTGCGAGTGTGCGAGCACACACTGGTCGGGGATATCTTCCGCAAGGGCATTTCGGGCGGCCAGAAGAGGCGGCTAAGTATCGCCATTGAGCT
GCTATCGGACCCGTCCATCTTGCTGCTGGACGAACCGACCTCGGGGTTGGACTCGGCCTCGACGCACAATGTCATGCAGTTCGTGTCGAGGTTGTGTCGA
GAGAACAAGACGGTGATCTGCACGATCCACCAGCCTTCGTCGCTCGTGTACAACATGTTCACGAACGTGGTTATCCTCACGGCAGGCGAGACGGTCTACT
TCGGCCCTCGAGAGCCCACCATCGACCATTTCTCGGCTGCTGGCTACTCGTGTCCGATGTACATGAACCCGGCGGAATACTTCATCAGTTTGGTGAACTC
GGACTTTGAGGGCCACGCTGACATCAAGCGCCTCGTGGCCAGCTACGCCAGCAGCGCGATGGCTTTGAAAGTCGTCGACAACATCGAGGCGGACGCTGCG
GGAGTCCACAACGCGACCCCCGTCGTCCCAGTCAAACCTTCGGCGCTACGCCAGTTCTGGGTGCTCATGCAGCGCAACTCGCTCAACAACGTTCGCAACC
CGGGTATTTACTGGGTCCGACTCGCCATGTACACCATGCTATCGTTCATGGTGGGCACCATGTACCTCTCCACCAACGACGCCATCTCCGACGAAGACAT
GGTGCCATTGCTCTTCTACGTGCAAGCCTTCCTGGTCTTCATGTCGGTGGCTGTGCTGCCTTTCTTCATTGAACAGCGGGCGGTGTTCCTGCGGGAGCGT
GCGAATAGCGGCCTCAACGTCTTCAGCTTTGCGCTGGCGAACTTCATCGCGACTCTCCCCGGCATCTTTGTGATTGCACTCGTGTCGACGCTGCTCGTGG
TTCTGCTCTCGGGTCTCAACGGGTTCTGGTACTTCCTGTTGAACCTGTTCCTGTCGCTGGTAGTGGCCGAGTCGCTCATGCACGTGATCGGAGCCGCTGT
CCCGCACTATATCATCGGCATCGCTCTGGGAGCAGGCATCTACGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCGAAAGACGTCATCCCGGACTAC
TGGATCTGGGCCTACTACATCGCCTTCCACTCGTACTCGTTCAAGTCGTTCGTGTACGAACACTTCATCCACGTGGACACCCCGGCAGCCAAGGCGATTC
TGGCGCGACTGAACCTCGAGGACGTCGACACGCCGCAAAACATGATCATCCTGGCGTGCTACGCCATCGGCCTGGAGCTCATCTTCACCTTCATCCTGTA
CAAGTTCCACACTGGGCGTAGGTAA