Description :
From Genome Similarity Track
Location :
Scaffold_32:970123- 972810
Sequence
2687 bases(100 bases per row)
GTACCGCTTAAGACGTCCAACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGCAGGTCGATTGTGTACGACGCACCATGTCTGGCCAGGGCTGCAAAT
GGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCAACAGAGCTGACAGTGTCAAGAGGTATATTCCTCGTGTCTAGCAACACTAAGTCCCCCACCTTAA
GTATACTTAAGTTTCCTCTTCCATGTTTGTCGGAGTACTCCTTTTGTTTATCTTGGGCCGCTGTCATGGCATCGCGGACCCTGCTGACAACGCTCAGCTT
GGTATCCATAAAGAATTCCACTTGTTTCCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTTTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAGCCCTGTGGATGCGTGCACCGCGTTGT
TGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCATGTACGTGGTGCTGCCGCGCACACACTGCTCCGAGTATCCTCGAGCACTCGATTGACGCGCTC
TGTCTGGCCGTCTGTCTGTGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGAAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGG
TCTCGGTCCGAGACAACCGTCTCCGGGAGATCGTGATAGCGGAATACGCCATCGACGAACAACCTTGCGGGTTGTTCGCCCGTAACAGTGACGGGAACCG
GAGCAAGATGTACCATCTTGTTCAGCCGACACACGAACACCAAAATTTTGGTGTTGCCGTGTCCCTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCAT
CGACTTCCAACAGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAAAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTAACGTAC
CGGTCGACCCACTTGTACATGTGGGTCCACCAGAAGGCCTGAGATACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGAGGATATCG
CGAGGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGTTAATTGGGCTCCACCCGGTAATAAAGGAGGCCATCCTTCAACTCATA
TCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGGCCTCGAGCTCGTTCCTTCCATAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCC
CGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGTGTGATGTGGGCCAACTCATAGTCAGGACGCAGAGAGAGGGCGTCCGCAAGCACGT
TGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTACTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGACTTAGTCGCCGT
CCTCAAGGATGCGTGATCTGTGTAGATCACGAAGGGCCGAGAGCCCAGAAGGTGAACACGAAACTTCACAAGGGCATATTTAATTGCCAGGAGCTCCTGT
CGTGGACAGGGTAGTTCCGCTCGGCAGCTTTGAGCTGCCTGGACTGGAACGAGATGACTCGTTCATGTCCAGCCGTGTCGGCCTGCAGCAATGCACATCC
GATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCATCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTGA
AAAGCATCCTGGTGCTCTTGCTCGCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCAAAGCCAGCGTACCCTGCGCTGTACTTGT
GAAGGTAGTTGGCCAAGCCCAGCCACTTTCGAAGAGGGGATCGGGGCGTCGGCCATACGGCTATGGCCTTGACCTTGTGTGGGTCAGCCCGAACGCCCAC
GTTGCTTACGAAGCAACCGAGAACTTTAATTTCTGGTGGCGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACT
CGGCTGAGGTGTCCTAGATGCACCTCCATGGCCGTTTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGGAGTACGTCTGTACGAAGGTACGCA
AAGGGTGGAACAGCTGCGTCACCAGGCGATTGAGCGTCGCCGGGGCGTTAGCCAGGCCCTGCGGCATGACGAGCCACTCCCAAAACATGCCGCTTGGAGT
GCTCACCGCGGTGAGCGAGATGTCACTCTCTCGCATCAGGATCTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCTATGTTG
TTTAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTCGCGTTGTTCAGCTTGTTGTAAGCATGAACAAGACGCCACTTTCCGTTCGGCT
TCTGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTTGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTG
TTCGCGCGGGAGAGACCATTGCCTCGTGACACAATACTTTGTGCCAGGCACGAGATCAATCTTATGCCGTACTCCTCGATCCGGTGG