Description :
From Genome Similarity Track
Location :
Scaffold_113:97005- 103963
Sequence
6958 bases(100 bases per row)
GAAGCCATTATCGCGATCAGGCATGTTTCCACGTGGTTGACGGTTGTCTAAACGTGCGTAGGTGCCTTCAGCAGCTGCACGGCGCTCATTTTCGTTAGCC
GCGGCGAGGTATCGGTCGTTTTCGTCCAATGAGAAATCACCGTCCGTATTATCAGGCTGAAAGTCGTTGTACTCATCTTGGACATCGTCGTAAGCGTTCC
GATCTTCGTTTGAATACTCGGTGCCTCCCTGAGCAGCTTCACGACCTTCTAATTCAGCTAGTAGGTCGTCCACCGTGGTGTGGTGAAGTGCTTTCTCAGA
AATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTCGCC
TGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCG
GATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCT
GACGGTGGATCTAGCAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTCCTGAGTTCGTATCCAAGGAGGGAGGATCC
CGCCTGGAGGGACCTGGATCCAGGGTATAGGGATGAGGGATACAGTGGATCTCGAACTTTTGTAGGACAACGGAGATCACAGACGATTGCAAGATGATGT
TGGATGATTGGAGAGTTCGGATCCACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACC
ATGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTT
AGCAGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGTCCTCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCC
CTCAAGAACCGGAGCTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATC
CTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGTTCTCAACTCTCAAGA
TCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGATCCACGATCTAGGCCC
CGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCC
AAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAAC
ACGGATCATCGGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCCGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCAC
AATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCCTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCG
GAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGATTTTTGGGAGGAACTCTGTCGACGGAAGATAGGTGGATCCGGATC
CGGATCTAGAAGAGAAACCTCTCTATCCTTCCCAGGTCCCCTCGGGGACCCCGGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAAGGAAAGT
GAAGGCGAAACGGTATGCATTTGCAGATTCACCGTTTAAGCCAACATCGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAAAG
AGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCCGTTGGCCCTGTCGGAACCGCCAAGTCTCTTTAGTGACGTCTTTAGAGGGCACTCCGTCAACATGTGACCCGATTCATCACACAGGAAGCACTTGCG
TCCGTTCCTCGGCTGGGTGTTCCGGAATCCGCTAGGAGGGTCACGCTCACATTCAGGACCGATGTGGCCCACTTCCTTACAGTGAGGACATGTGGCTTTG
CCGCGGCGACAGTGAATACGACTACACCCCAGAGTGTGACACCGACCGCACACGAGAAGACCATCTTGGGTTCGCAAGTCCGGACCCACACGAACGCCCC
TGATAGGCGTAATAGGAAGCGTTCCGATAGGCTGATAGTGCAGAGAGGGGTTCGGATCAGGAGGAGAGTAGGCAGCAGCTACATTCATCGCTGGGGAAGC
ATAGGCGGTCGTCAGAGGACGCTCCATCAACTGCTGTTGCTGTTGAAGTTGTTGCTGTTGCTGCTGAGCGAGTAGATTCTGCGTCTGCTGCATCATGTTC
ATCATGCGTTCGAGGACAGCGTTCTCTTGGGAAGCTTTAGGGGACGGCACATTGTCGAACTCGGAGTCGTCTTCAACCGGACGGTGCATATTCTTAAGGA
GCAGCATGGCCACAGCCGCAGGGATGGAGTCAATCATTGTCGTGGTGAGGGCGTTCCTCCAATCTCGGTTCCGAAGTCCAGACAAGAAGTACTGGTAACG
CATCTGAGTGTCGTAGCACTGAGCATCATCGCAGAGACTTGAAATCATGTCGCCCCACACTTCGGCGGACATTCCCCGGGGTCTTTTAGTGCTCTTCAGA
TTCTCAATCAGTTGCAAAGGGGTCTGACTGATGAACTGGTTATGGAACCGAGTTCTCAGAGCCTCAAAGCTGTTGATGCGCGAGTACATCCACCAATCTT
CGCCGACCTTGCCTTTCAAGCACTCCCTGAAAGCGCTGAGACGCAGGGGTTCGTCCAGCCCTATCGTGGCGTTCTCGAAGGCCTCCCAGAAGGATCTAGC
TTTCTCCACCGACGCTCCTTCCGAGTAAAAGGGTTGGAGCATGCGAATTGCGTTTCGGATGTTAGTGGGCATACCATACTGGCCACTAGTAGTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN