Description :
From Genome Similarity Track
Location :
Scaffold_156:97004- 100985
Sequence
3981 bases(100 bases per row)
TCGACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAATCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTG
GCGTCCCAACCATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGT
CGGCTTGAAGTGGGTCTTCTACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTAGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAACACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAAC
TGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACA
GCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
ATAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCG
GCTTTGACTCGGTGATACGTTCTGACGATGCCTTGATGCCCCCCGTCGATCGAGTTGTGGCAGTTATGAAGTATTTCGTCGACCATGGTTGACGGAATCA
CCAATCTCAATGAGAGATTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTACAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGC
GACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTTCTCCACTCCACCTCTCAGGTACGCCTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCC
TTCGCGATTCGTCGTCTCCGCTCAGTCCGTACCGTCACTGGATCAATGTCGTTGGCATTCTGAGCTGTCTGGGCTGACTCCATCTGCGACCCTGTTTCGA
CATTCGGGGTCGTGTGGTTAATCCGCCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTTTCAAACGCGGATTCTCCAGGATTGGTAGA
CATGGCTTCATGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTGACTGCC
GTGACAATCGGTGTTTCCGCTGGGTTGTCTGTGGCGTACAGTTCTTCGGCTACGCGGTTAATCATTCTCAGCTCTGCTTTCCTATCCGTCCCAAGAATTA
CTCGTCCAGCTTTAGCTTCCAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGTTT
CGTGAGATCCTTGTGCCGAGCTAGTTCCACTTGCAACGTTTCCTTCTTGCATGCTATCACCCCATGGATTGCTGGATTGCAAGCCGGGAGTCACCCACGA
TAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACT
CGCAGCAATCTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTGCCATACCCGCCGTATTTAGCCGTCTTCGCTGAGCCATCAAATGAC
AGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTGGGTCCATTCGAACTGTCGCCGAGTTCTTGGAGGGAGGTGCCAGGTGCTTCA
AGGAATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAACTGGGCGAAGTCTACATCTCGCTCACGTACTCGTTTCACCTTCAAATCGTAGGG
CGACAACATAACTGCGAAACTGACTGTGCGACCGTACAGCGACTTTGACTTAAACACCCACTCCAGCGTGGAGAAACGGGTGTAGACGTGAAGCGTCTTT
CCCGCCAAGAGAGTGTAGCACAATTTCAGCAATTGCACCAGCGCGACTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCGCTCTCCTTTAGTACGCGTC
CGCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGTGGTTGCATCAACGTACTGCTCAGTGCCCACTCATTGGCGTACAACATTATATGGCCTTCTTTCGC
CGAGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATAATGCTTTTGCTGACGCCAGGTCCCCCCAGGGCCAAAGTCCG
TATCCGTTAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCCCCTTCTT
CGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGT
TGGATCAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTCCC
CTCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAGGAAGACTGGTCAGGTTCTCCATCAGCAAACATGTCGCCGTCCGGTCC
ATTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAGCTTCGTCAGCTGACTCTGCGTTGAATCGCTGATTCCGTCGAGC
TCAACTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGTTCGGCAAACAGTTGCCATCCTCCCTTTGGTTGAACGTATTTCCATAGAGCGTTGT
CGATTAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAATGGCATTCGTAACCATTCAAAGTGTCCAAGTGCACATACGAACGCTGAGATCTGCCG
AGCTCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAGCTTTCCAATTCGGTAAGCAGGTCATCAACCAGT
GGCATAGCGTATTCCATCGGTGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGTCGAATATCCACACCATTTTTCTTTAGCACTATCACCACTG
GCGAGGTCCAAGGGCTGCTCGAGAATGATATCAACCCAGCTCGAAGCAGCCCCTTCAACAACTCGTAAAGTTTGCTCAAGTGGCGGAGAGGTATCCGCCG
AGCTCTCTGCTTAATGGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATTACC