Description :
From Genome Similarity Track
Location :
Scaffold_10:97- 4061
Sequence
3964 bases(100 bases per row)
ACTCGCTCGCCGAGTCCGACGCGACCACCATGTCTGAATTCTCATTCACGAGCAACTAGGCTAGAAAGAATGCGCTAGTTCGTAATATATATTGAGATCC
AAGCTCGCAAACTCTCTCGGATACAGTTCTCGAGCACTACAAGTCGCTTCAAGGCAACGCAAGAGAGTCAAAAGTCCTGCTGGCGAACCAGGTCAGCTGG
AGATCTGTTTACTTTTGCTTCGTCATGTGGTGCGAGAGCGTCAAGCGAAGAGGCACACTCGGGCGACACATCGTCTGAATGCACACAGGACTTTACGATC
GGTCGCACCGATTTATTCTAGGTCGTTTCGGTCGACATCGCCATCTGCCGCGCCTCAAAACAGCAGCGAGCGATCAGAACCGAGTTTTCCCATGGCGCGA
GTCCAGGTATAGGGCAATCCATCGGCGCCAAGCTCTCTGTCAACTGAGTTGGATCGAATATAGCCACGGGTAAGAGCCTCGGGTGAGTACGGAGAAGGCT
GTCAACTGCCGCCTCGCAGAGAGAGGCCGAGATCAAGAGGCTAGGAAGACGACAACCTTCCTACCCACGAACGTGGCCAGAGGATGTAACGCGCCGCTGG
CATCTGGTCAATCCAACCGTCCGATCAGCCACGAAGGCGGCTGCGTGGTGGACAGCTCGCCTCGCTCGCGCCATCCACTGGTCCGCTCCGAGCGACTCAC
TTTCGCTTTTCCTCCGAAGCCTCGACCTCCAGCTCGCTGCGCCGCCACCATGGTCAAGGGCCGCTTCATCGTCAACCCGTTCGCCGAGCTGGCGCTGACG
GCGCAGGACCAGACGAACCTGATGGAGCTGGCGAACACGCTCATCCACGCCAACCTCGAGCGCTACTGGGCGTACGTCAAATCGGGCAAGCGCAAGGTGG
ATTCGAACCAGTGGAAGCTCACCAAGGAGCGCGAGAACGTACAAGTGTACACGGAGCGGCCGAGCGCCGTGGCGAAGCGCGGCGACGACAAGTTCTCCAT
CTCGGGTCTGCCAGCGCTGCTCTCCGTCGGCACCATGGTCGGCAAGCTCGACGACACCATGTACGGCGTTGTGAACGCCACACTCGAGACGATGCGTATC
AAGGCGTCGTATGTGGACGACATCCAGGGTGCCGCCGTGCTGGCCACGATCCATGAGCCGTCGCCGGACGATCCGTTCCAGTCGCTCGTGGTCAAGTGGA
TGGAGTTCGACATCCCGCTCTCCTCGCTCAATCTCGTCAAGAACCGCGACTACATTTACGTCGAAGGCACGGGCTACGTTTACTTTGAGAACGGCGAGCG
CATCGGCTACCATTTGCTGCACTCGGTCAACTTCCCGCAGACCCACGAGCTTCCCACTCGCGTGCGCGGCAACGTGTCCATCTGCGGCTTCTTCCGCCAG
ATTGGCGCCGACGTCATGGAGCAGTACGTCACGGGTATCATGGACCCGCGCGGCGACATGATCCGCGTGCTCGCCGTGCCGAACATGGCCTCGGCCTTCC
TCTCGACCCTGAAGTACGCGCACTGCGGCCAGATGAAGAAGCTCGCCTACATGCTCGAGCGCAAGTACGCCGAGGCCAAGGAGCACGGCACGCCGAACCG
CGAGACTGTGTGCGTGACGTGCTCGTGCAAGATCTCGGGTCGGCGCCTGGGCGACTTTGGCAAGAGCAGCAGCACCTGCAAGCTCTGCTTCGGCTTCGTG
TGTCCGTCGTGCAAGATCCAGAAGAAGATCAGCTTCGTCTCGCCCGACCTCGAGCTCTCGCAGCGCAAGGTCACCTTCTGCACGCGGTGCCTGACGGAGG
TGACGCGGATGAACGCGGCAGAGATCGCGCGCAGCCAGATCCTGACGACCGGTGGCCACGCCAAGCCGTCGTACTTAACAAGCTCCATCCCAGGCTCGAT
CTCGTCCGAGAGCAGCACCGTCTCGGATATGTCGCCCTTCACGAATTAGAGCAGAATGATTATTGTGAGAGAGCGCCTGTGCATATTAGCTATCTGCATA
ATCAAGGCCTCGTTGTGATTTGAAATGGAGGTGGAATATTGTGGCAATGATCGAGATTGCAAGCTTGCAACAAGATACGATGCTAGGGCGGCTGGATGAA
CTACGATATTTGTAGCTTTCAGGATAGCTGTCCTTGTGCCTGGGTTTGGGTCATATCGCTCGTGCATCAGCTTCAAACACAGCTTGATCTACCCTGCCTC
ACTGGCCGTGCCAATACCTGACAGCGATTGCTTCGTTTCGCTAGCCGAGTTGCAAACTCCCCCAGACACGTCCCAAAACCGCCAGCGTAAAGTCGATCGT
CGCCTGTTGGACCTCACCGCGAAGTGTAGCTGTCAACTGCAACCACCCGCATGAGTCATGGCCATGCTGCACGACCCTCTTTTACGATCGAAAGCGCTTG
TAAGCTTGTGCAGCGTGGAAACGAGCAGATCTGGCAGCGCTGCTCACCAGGTGCGACGCACTGAGATTTCGCTTGACGCTGATTGGCGAGGTACGCCGAC
TGTCGTCACTGCCACCCTACAGCGGTCGATCGCGCGAGCGATTTGCAAGTGCGCCACTGAGGAGACCTCCTTTCCTTCCGTTGCCGCCTCGCGACACCGT
CTCCGCAAACTAGATGACACAACAAGCGAGGAGTTCGCACAGAACAGGACTGTATTTGTTGTCGTCGTAGTGTCGCGGGTGTCCTGCAAAGCGACGCTTG
CAACAAACGATCCAGCAGCGACATGGGCACAGTTGCAGGGCACCGCTCGCGATCAGAGGTCTCCGTCCCACCCTAAGGCGTGCTTTTATCCTCGCGGATG
GTGGATGGCGCTCGAAGCCTCTACCGCTGCACCGCCAAACACTGCCGCGACCGTATATTGCACTTCAGAGCTTCAGACGCCAAGCATTTCACCGTCTCAA
ACGCAACCCGGTGGAGGATGGCTTGAGCGCAACTCTTCAGTCGATTGGAGCCCGTCCGAGCTTCAGTCTCGCCCCTGATATACAGTGTAAGGTCGCTACA
GGCGGTAGATACCACCACGAGATGCACGGCTGGAGAGACAACCTGTCGAAAGTGGCTCCCTGACATGGTGCAACGGCTGGAATGCCGGAAATGCGGGAGA
CTGAAAACTTCAACAAAACTCTCAATAGATAACCTTATTCAGTATGCTATCGGTACTGCCATTCGCAGGTTGAAGCTCATGTACTGACTCAAATGAGTAG
AAAGAACGGCGGGAACTTGTGGTGCAGAAACCCGGAGCAGTCCGCCGCGCCTGGCAATGCTGCACCTGCTTGACACTGTGCGCCACGCCTGCGTGACCGC
GGCTGTACCGCACAGAAGGGGCATCCGGTGGCCTCTTGGTGGCAGCCAGCGCTCCTGCGGTAGTCCCGCCCGCAGTCTCCAACTTGCGGTCATGGCCAAG
GACCGGTTCGCCGACAACCCGTTCCCGGACGTGGAGCTCTCCAATGAGGAGCGCCTCCAGATCCAGACCATCGTGAACGGCATCATCGAGGAGAACTTCC
GCAAGTACGAGAACTTCGTCGTCGTGGAGAAGCAGAAGGTGGATGATCGTCGCTGGAAGCACGTCAAGTCGAAGGACGACCTGCACATCTACGTCGAGCG
CACGCAGCCCGAGCTCGCGCGCAATGGGCTCGAGTCGGAGCTCGGCGTGAGCCAAGCGCAGGCCGGCGCGTCGCGATCCGACCTGCCGCTGCTGCTCAGC
GTGGGCACTTTTGTCGGCCAGATGGACGACCTCATGTTCNNNNNNNNNNCGTCGTGAACCCGGCGCTCGACATTATGCGCATCAAGGCTTCGTACGTGAA
CGACCTGAGCAGCGCCGCCGTGCTGTGCCCGATCGTCGAACCGACGGTGGAGGATCCGTTCCGATCACTGGTGATCAAGTGGATGGAGATCGACATCCCT
CTCACTTCCACCAACCTCGTCAAGATGCGCGACTATGTCTATATCGAAGCCACGGGCGTGCTCC