Description :
From Genome Similarity Track
Location :
Scaffold_1778:97- 3708
Sequence
3611 bases(100 bases per row)
CTCTTGATCGCTGACGTTAGGGGACCTGGAGGTATTGTAATAGACCTGGTACCTTGGATTTACTGTAGGCACCCACTTCTCACCCGAGTGACCCACAGTT
TCTCATGTTCCACCCACTTCAGCCGATCTGGCAGTTCCCCAGGTCTCTCCGGGCTCGATCCAGGTTGTCTAATCCGGCCCTTATGATCCTCATCTTCGCC
CCGTACAACGGTCGCCGTCCGCTGAGCTGGATTCGCATCTCGTCCGGGAAACACAGTGTCCCATCTGCCAGATCCAACCTTACTCCCGCTGGTACCATGA
AATCCATCCCGAGGATGGCATCTTGACCAGCGAGGTCTCCAACCCAAATGTTGAACCAATATACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCT
CCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCTCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGT
ATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGT
ACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACGTCCTCGGATCCACAGGATCCAGTGACCAGACAGAACTTAGGTGGATCTGC
AGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGCTGAAGAGATT
TCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTAGATCTAGGGGTCCTG
CTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAA
CATCTTCTCGGCCACTTCTGGCAACATTCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACG
TCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAG
ATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTGGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGG
TATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGAGCGTTGGACGCAGTGAGACAGACTTGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTC
GGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGCCTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCG
ACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATTTACCGCCCGCAGCACTTCCTCAAGCGCGTCTGCGTCGGGAACACGTAACAGGGTCAGCCTGTCGG
CCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGC
CACATTTAGTCGATGCAGGTATTCTAGCGGGGATTTATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGG
GTCTGGAAACTGCGCAGCAAATCTGGCCACTTGCTCCTGGTGGATCTACCCAGCTGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGG
TCAGACACTTCTCGGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACCTTGCTGATCCATGTTCTCGCTCGATCCTCGTCTTGATCCTTGCCCGT
GAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCCGCCCCGGCTGCGGCTGTTGCTACCACCGCTGACGAAGGG
GATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTT
GCACTTGTGGCACGGCCCTGTTCGGCCAGAAACCGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCG
TCTGGTCCACTGGCGAGCCAGGATTCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAACCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCT
GGATTGTATCAGAGTACGGGTAGGGCGTACTGGATCCCGAGTCTTCACGCTCAAAGGGACTTCCTGTCCCCGGATCCTCGCCCGCGCTTCCAGCATGGAT
GCCCCGGAGGGCTATAAAGTCATGCGTCGGGGCTCGGACGACGTGTCGGAGCCATCTTCCGCCGCGGATTCGTAGTTCGAGGACGTAGCTTGGCTGATCC
TCGGTGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTC
TAGCTCGAAGATATTCTCTGCGTCGAACACGCCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTT
TTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTCATGCAGGAAGTCGCGTAAAGCTTGGT
GGCGATACACAAACTCAAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTT
ACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGGCTAGCGGGGTTGGGTTAAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCC
TTCACTTTCCCTTGTTCTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGAT
CCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGAATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGA
CGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTTACGGTGAAATCCCGAGTCACCAAACGATCCGGGCACGCGCACCATTGTG
GTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGAAGTCCCCCGATGATCCGTGTTC
TGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAGGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGC
GAGACGTGGGG