Description :
From Genome Similarity Track
Location :
Scaffold_3119:97- 1551
Transcript NameFunction/comments
Phyta_totarag15082hypothetical protein PHYSODRAFT_341107

Sequence
1454 bases(100 bases per row)
AAAGCTCACTAGCAGAAAATTTCCCATGTAATGTGTAGTTGGGTACGCTGCTGTGTATCCGAAGTGGCGGTGAGCCCGCGGCACCTCGGCAACCTCACTG
GCGCGCATGGCGAGAGTCAGAACGGGAGTCTGAGCGGGGATCCGAATGAGAGTCTGAACGGACGTCGCGGCGAGAATCCTCGCGGGAACCAGAGTCCTGA
TGGTAGTGACGGCCGATAAAGTCTTGTACGTGGCGCGATAGCCGACGGTCCCACACGTTGCGTGCACGTGGTATGGGCACACCGATCCGCACTACCACCG
TAGCACATGCCGCCGCTCATGAACCGCAAGCAGGGCTCGCGGAATCTGACGCCGAATATGATCGGGCATAACCGGCACGCGACCGGGATGGACCCGGCGC
GGTGCCGGTGGTGCGCTGCGTGCCGATGATGGGCGCGCGGGGCCCACGGACGCTGGCGTtcgagcagcgagacggAGCGCTAAGCCGTTGAGTGCAGCTT
GCCAGTTAGCTGCGTGGTAATCAACAGCCCGCACCGCCTCGCAATAATTGCGCCACCAGTCGGGTGAGTCCTCCACGAGATGCGCCATTGCCCGGCCCAA
AAAGTTGTTCACATAAAGGAGAGTCAATGTGACGCGTTCCTGGGTGTTCGTATCCCTCTCCATATTTGTTAGTACGAAGCGTTTGAGCCGGGACGTTAAA
CGCCGAACATGGTCGTAAAACAGCGTGTCGCCAAACGAAGTAAGACCGCTGATAGCTGCCAGCAAGTCTCCGTATGTCCCGCACTGCGGCATCGTCGCCG
GCAGCATGGCACCAGCCCCAAAATCAAATGAGAAGTTGGCGTTCATCGATCCGCGCCTGAGTTGCTCCATTTCCGTAAACGGCTTGAAGTGCAGGATAGT
CAAGCCGCGGTTGCCGAGACGAGCGCTGTACAGAGCCATGAGaacaggggggggggcatcgAAGGGGACGCACTCGAGCTCACGCAACTGCAGGACAAAG
GACATGGGAGTAGTGTACGCACCTGCCGCAGTGCTCAGTGCTTTGTAGAGCCTGGGAGCCGCGAGTTGGTGTGTTTGAGGCGGATGGTACTCGCCCTTTA
CGCGTGTCCGCGGCGGTGGAAAGCTAGTGCACCGCAGGTTCTGAATGGTGAGCGGAGGCATATCATCCGCGTTACCGTTCGGAGGGAGGGTCCAAACCGA
TGCCGCGAAACCAGACccgccgtgctggacggcatcgtGAGCCATGGCACCGGTGGTGTCCACGTCCAAACGGTTTACCGTCGTAGCAGCGTGCGGTGGC
GCCTGCATCTGCTCTCGGAGCTCGTGGATCATCGCGAAGAGCTGATCCACTTTGCTCTCCAAGGACGAGCCAGGAGCCGCAGGTTGCGTGGACTGCGGGG
CCGCCGCAGGCAGCGGGCGATGAAATTCCTCCATGAATTCGTCTAGGCTAAACG