Description :
From Genome Similarity Track
Location :
Scaffold_286:9698- 14033
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19993hypothetical protein

Sequence
4335 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAGTTGGTGCTGTGGACTTTGAGTTCCAAGACTGGATCCAGTCGCATCCCATCAATCCGTCCCTTGCTCCCAGAAACCAACTGTCACTTCACCACAA
TCGTCCCCTGAGTGAGAGTCCACAGCACCAACTGTCGGGCTTCACTCACCGATCTTCGTCTCTCACAGCAACTTCTCGCTTTCGTCATCACTCACCTCCG
GTGTCAGCACCACCACGGCCCCATGTCTTCCGGTAAGTCCACTCTCTTACGTCGTTGGCTTCCCTTCCGTTGCTAACTCGCGTCTTCCGTAGACAACGGT
GCTTTCCTCGACCTCACGTCCTCGCCGGGCCCTTCTTCTCGCTCTGTAGCACGCCGCGGCTCAGCCGTTGTGTCGACTGTCAAGCTGGCCGATCCTTCGC
TGAACCTTGCCGATGTGCGGGTCTCGCTGAGCGCGTTGCAGCAGGGCATCGACCAGACCGAGGCACTGCGCGAGCTTCGTTCGAATCATGAGGATCTGCG
CCGCGAGTTTCTGGCTTTACATCGTCGTGCGGAAGATCTGGATCGTCAGCTCGCCGATGCAGCCAATGCTGCGTCTCCGTACGTGCTCTTTTGCCAGCAC
AAGAACTCCCGTGAGCTTGAGGCTTGCCGTCTTCGGTATCGCAATTTGAAGCGCCGCTATAATAAAGCAGTATCGGAGTTCCACGATCGGATCTCCACCT
TGGAGGCGCAGCTGGCCTCCGCCTCTTCCTTTGGCGTGATCATTCCGCCCGATACAGCTCGTCTCGAAGCGGATATGTCGTCCATCGCGCCGAGGAAGCA
ACCACGCCAGCAGATTCCAGCGGTGATACCTACGGTTGAACAAGGCGAAAAACTGTTAGTCGTGAGTTTCGACGGATCAGTACGAGTCAAACGAGGCGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
ATTCAATTGCACGTGGACGTGCTTCCTACGTCTTCTGCGAAAGGCTCAGATTTGTACTCGGTAATGAGCGTCTCAACAGGTGACGACGCTCTGAACGGAC
CAAACACGGAATATTCTGTAGCCAAGTGTGATTGGACACGTTCGTGCTTGTTTATGACTACACGGATCTTACCGTGTCGCCGTGTCTTCTCTTTGAGGAA
GGCAATCCCCATGGAGACTGTGATCCTGCCTCAATTGCTGAATCAATGATGATTACAGTCATCGGTTCGAGTTGCGTTCGATTTAGAAATCGCGGGTGAG
AGATATCATCACTTGGCCCATTCATAGTACGGCCCGTTCTAACTGGAGATATACGTCATAGGATTTCAAATCGCTAGTACCACGAGGTTTTGCTACTGTG
AGCGAAATATGCGAGTCTATGGTAGGCTTAGTATGGCAAATTATCGGGCTGCAATGATTTTTTTGAAGGAGCTAGCGCGTCGTTTCAAGAAAGGCGATTT
CAACCCACTTAAATTAAGTGAGCCCATGAAGAGTGATACAAACAAAAGTGATGGCAGTTTGGATCAGAATATTAGTGCAGAAATATCACCTACTCAGTTG
ACATATATGCAATCTGTTGAAGTCAAGCCTGTTGTCTTCAGTGGTTCAACAGACCAGTCTATCGTGTGTGGTAATGGTCAGGAGAGTTTAGTATCTAGTC
TGGCGAGTCTGGTACCAACACTATGGAATTAGCAAATAATAGCCCATTTGAAGTGGCAAGCCCTCCGAAGTATCGTGGGCGTTCGAAAATAACTTCTAAA
GCAAAGAAGGCTGCTCGAAACAAAACAATTTCGATGGCAGAAGACGACCCTATAATGGGTCCATTGATGTTAGTTCTCGCTAGAATTCTACAGGCAGTCA
GAAATGGACCCACATCACTCATTCTGCCACACTTATCTGACCCTTCAAGGTGTTTGGTTCCGCCAGGAAATCGAGAGTGCCGATAGCCATCAAGATTTCT
TTCATGACCTCGCCGAAGCACGTCACCCCCGGTCACCTCAGTGACGTGTATATTGCGTTTGGATTACATCGACAAATACAAGAAGGGCTAGCATAAACAC
ACGAACTAATCAACGAAAAAGAATATAGGAGAAGAGGAAGTAGTTGTGGAAAGTTTTAGACTGGCATCTATTCGACTAAAACGGTTGACGTGATGAAGAA
ATGGCACATTGCGACAAGAATAATTCGATAAGTGGACAGGGCTGCGGATTGGATTGACACAATCAATTTTTCCGTAAAGTCCGAATTCAGTAAGACAAAC
GGATTCAATTCGACAGTCGTAAAAAGATCATCCTC