Description :
From Genome Similarity Track
Location :
Scaffold_103:9697- 15032
Transcript NameFunction/comments
Hyaar_Emoy2809505hypothetical protein

Sequence
5335 bases(100 bases per row)
TCACCGGAAGAAGTCCCGTACCGGTGATACGGCGTAAGGCGACCGAAGTAAAACGTAGGATACGTGCACATCTTACGTGGCATTTCAATCGTGTATGCGT
TGCCTAATCAGCGCAGCATACGAAATATACCGATGAACTTGGGTAGTAACCTGTTACTACCCACGTTAGTCACTATGTGTAGAGGTAAGTTTACCGTAGA
TAGTAGGACTAGGTCACCTTCGTTGAATGAAAGAACATTTGACCTTCCATTCTTGTCTACATTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCT
TGCACGAAACGGACAACCGTTTCGCGAGCCAGTATGAATTTATCTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGGAGCGCACTGTGGCAATATCAG
TGACCTGGGTGGTAAGAGCATCCTCGCTCATAATTTCCTCTTCTTCACCGAAGTCGATGTGATCTACATTGGCGTCATACGTAGTGACCTTGTGGTCAGT
ACATGATGAGTGAGAGCCGACTTGGCGTTCGCTCGAATGATTCCCTCCCCCCCCTCAAACTAGAGTTACGCTCTAAGAAGGTGGGTAGGCGTGGGTGGCG
CAAGCCATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGTCAAATTCCACCATTGGCAAAAATTCACTCCAATTCGTAAAC
GAATGGACATAACCCCGAAGGATTTCCTCAAGAACGCGGTTGGCATGTTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGTAGGCGCG
TTCCGAGTGGTTTGAACACGGATCGCCAGAATTTAGTAGTGAACCGCGGATCTCAATCGGAGACGAGTTCACGAGACAACCCATGAAGACGAAAGATCGT
GTCAATAAAAACACGAGCACATGCCGATGTGATAGATTCAGGTACAGCGACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAAGAATACCTGTA
TTCTTGTGTGGGTCTACGGGGAATCCAAAGACAAAGTCCATTGAGACTGAATCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACAAAGTG
AAGGACCAGATTTCACTCGTTGACATTCTTCGCATGCGTGGACGTACTTGCGCACGAACTGAGACTGGCGGGGCCAGTAAAAGTCGCGACAAACTGTGAG
ATATGTCTTTTCTCGACCACGATGCCCACCAGTAGGTGCATCTTGGCACTCATACATGATGCGCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGA
GGCGTGTCGCCGGCAACGGCTGAATACTTCAGTAAGCCATTGTGGGCTGTATATCTATCCGTGGAGGATCGACATACTGGGGGCAACCCTTTAAGGGATT
GACGGGATGGTTGCGAGAGATGACCCATCAAACGCACCATCGCCGGATCGTACGCCTTGCGTATGTCTTTGAATAAGGTTGACGACACTCGACGTCAGCA
CCGCGACAGTGTTCGGACCAGTGTCGGGTTGCGCAGCCGATTCGAAATCGGGTCGGCGCGACAGAGTATCAGCGACGACACTCAGTCTTCCTGGCTTATG
TTCCATGGAGAAGTTACACTCCGCGAAGAACGACAGCCACCTCGCCATTCGCTGCGAGAGGTGTGGACTGTCAACGGCCGTGCGTAAGGACGCATGGTCC
GTGTAAACGATGAAGGGTCTATCACCTAGCAGGTAGACCCTGAATTTTGCCAAAGCATACTTTATGGCAAGGAGTTCCTTGTCATGGACTGGGTAGTTAC
GTTCAGCCGGGTGCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCATCTGTGTCATACTGCATTAGTGCACATCCGATGGCAAAATCACTTGC
ATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGTGTATCAAGCTTTGCTTGATACCTTTGAAGGAGCGCTGGCAATCA
GCACTCCATGCCCACTTCTCGTTCTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGTGCGAGTATGTGCAAATACGCCGCTAGACCAA
GGAACTTTCGAAGTCCTTTTATTTTGGAAGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATAGGGCCGGACGCCGTGCTTACCCACGATGCA
TCCAAGAAGTGGTACTTTGCTAGCAGCAAATATGCACTTCTTGAGGTTGGCATACAACTTATGCTCACGCATCAGTGTAAAAACCTTTCGGACGTGGAGT
CGGTGTACTTCCACATCCGTCTGTCCATCCATAGCCCGGCTATGGACGAACACTTCATCGAAATAGCTGGGTGCGAATTCTCACACTGATCTCAACAGAT
TCGTAACACATCTTTTAAACGTAGCAGGGGCATTACTTAGTCCTTGTGGCATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGCTCAATGCTGTATA
AGGACGTCCTTTTCACGCATAAGGATGTGATAGAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGCCATACCATCTATAATGACATCCT
TTCTTGGTATTAGCGTTTGAGACGGTACAGTCGCAGCATTCAATTTGTTAAAGGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGGACACAGAAGGT
CGGAGAGTTATGCGGGGAAGTAGATTCCCTCACATGGCCCGCTGCCAAGCGATCGGCAAAGAGTTTGTCAATCGCTAGTACTTGTTCACGAGGCAGTGGC
CATTGCTTCATGACACAGTACTTTGAACCTGGTTTCAGGTCGATCTCATGACGAGTACCCTTATCCTTGGGTAGATCGCACGGCACTGTTTCTGGGAACA
CATCTCTGAATTCCGTCAAATCATCGTGGAGAGGATTTGTCTTGAGCGATTCCCACAATTGAGATGTATACCGCTCAATCCGAGTCTTCTCATCAAGGAC
ACTCTCGTCCATTGATGAGCTGCTGACAACCCTTTCGTTCTCAGCGAATACCATTGCTGACCGAATATCGGTTACGTACTCATCTTCCGCGACGAGTACG
CAAATTTGCTTGACTTTGCCACTACGCAGATCACGCAAGAACCTCTTCTGTTCGAGGGTGGTCAATTGAGTGATCTCCGAAGTTGTCTTCGGAGGCGCGA
TCAGATCAAGTTGGTAAGTGCCTATTCTTGATCCGTCATTGACTAGGACATTTGACTTTTCTGTTATCTCCTGGGAACTTATTTCTACAGTTGGGTAGGG
ACTTATTCCCTCACTAGCCTCTTGGGCTAAACCATCACATGACACGAGTGGAATTGCTCCCTCGCTATCTTCTGGCGGTGGTTGCGCTACCGCGGCCAGG
TCTTCTACGTGCGATTCTCCAATCGCACTAAGATCATCGTATTGCCAATCATTGGAAATCGGTTCGTTGTCACTTGGGTGTCGACCGTTAGGAGGACACC
CATGCCCCAGTCCACTCGACTTAATCGGGTGGTGGGCCTTCGGCGCGACCTGCATCTCAATGCAGTCGCCGGAATCTGGCTTCATGGTGTGGCGATCAGT
CACGTCATGGCCATGTGCAGTCATACTAACGACCGAACCACACGCGAGGACATCGCACTCGCTCGTAGTACACCCACATGTTAGTGGGCGCTCCATGGCG
TTCATCGGATGGCCAGATGATGAACAAGTGACAGGCATATCGATTGTTTGTCGATGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAA
GGATAGCATCAAATTTGTCATCCAAGTCTGATATGATGAATTCATCATTATATTGGACTCCCTTCAGCGTATAGGTAATACCCACTACACGTTTCATCAC
TGTTACGGATGCGCCTGTCGCGAGGCAAACCGTCATCCTCGTTGGAGGGATCTCGCGCTCGATATATGGGATCTCGCTGTTGTCTAGCGATTGGCGTCGT
ACAAAGTTGTTCGACGCCCCATAATCGACTAGGGCTCGAAGCGACATGTTTTGTGTCACTTCGACTTTTCAAGGCTATGAGGGAAACCTCATTACCAGAA
GCAGCAATACACAATGATTGAGTGTTGGGAACAACTTTCGTCAAGAGGCCTGCAAACTCACTCGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTG
ACCCTGACCGTTTTTTGGCTGTCCGTTTCGTTGTTGCGAAAACGCAACAACGTCGTACCCACGTCTTGGACCCCGCTTGGTGGTTATTGTTTCCTGCGGT
ACGTGGTACCGCGCTCGGGGCATTGCATTCGTATGCATAATGCCCTGTCTTCTGACATCTATTGCATTTTTGCAATTTCTTGTAGTTTTTAACACGAGAG
CTCTCGCTCCTCGCGTGACAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCCGTCGTCTTGACGGACGATAAGAATTCGAATTCGCGTGAGCCTGTTTCA
CGCTGAAGTCCTCCTGTTCCGCAACTCTTATCGCCTCTTCTAGGGTGTTGAACTCCAATCGGAACAGGTAGGTTTTAACAGGACCATCAGTCAGACCCTG
CATGAACAACGTAATCAACGTCTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGGCGTATGTACTGAGTGTACGTCACGTTTACCTTGCTT
AATTCTCAGGAGTTCAGAGCGACCCTGAACTCAGCTTGCGGCGGCTCAAATGTTTGCCTAAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATG
GGTCGTGTAACTTAAGGCCCAAGGCCCATGTCTTTGCACGCCTGCCAAGTTCGATTGAGCAAATGCGATCTGCATTTGCTCATCGACGATGTGGTGAGCC
TTTATGGCATCGTCTAGTTCCACGGACCATCTTAACAGAGAGTCTTCACCGGCTCCCTTGTACTTTGAGATGTCAATATTTAGAGTCTCGGGTCGACGTA
TACACGTCGACCCGGTAGCAGTGGCCTGCTGCTGTCTCAACACTTCAAACTGTTGAGAACCTTGTTGGTGAAGCAAGGTTACCTTTTCCCGCTCGACGTC
AAGTTCATTCTGAATGAAGTCGGCGATGGTGGCGTGCTGGTCGTCTGGCCCCAGGGCGGACAGCAGTGCGCCAACGGCTTCTTGCCCTATCGTTGAACTC
AAGCGTTCGACGGCATCCCATTCGACTTGACTCAAATGAGAGTAGCTTTCATGCGTGGGATGAAAATCGTCCCCTCATCGTCCAACATGTCCATGGTCGT
TGAACGGACTACGAAGTGCTACCAGGTGTAACGGG