Description :
From Genome Similarity Track
Location :
Scaffold_184:96967- 100913
Sequence
3946 bases(100 bases per row)
CTAAGTCTTCCTCTGACTTAAGGAGCTGTGTAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACGCCTGAGTCTTTAAAGACTGATCCTCTGTGA
GGATGGAAAAACCCACTCCCTTCTCTAAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTTGTATCGCA
AGGCCCAGAAGTGCTGACTGCACGTGTTGAGGGCTTCTTGCAGTATGAAGCGTCACTTCTAGGGCAGGTTCAAAACCAAATGGCGTCGGCTATACCTACA
CGCTATGTGTCTGTTCCAGACGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAGTTAAAAACTACTCAGGAAAGGAGGGTGAAAACCTCATCCTCTGGA
TCCGTGAGATTGAGATGGCCATGAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCACTGGCTATCTCAAAGCTCGGCAGAAGAGCTAGAGAATG
GGCCTTGACGTGTAGCAAGTCGGTCTAATTAGAGTTTTCCACATGGGGGTCGCTTAAGTCACAATTGGTATAGGTGTTTTCACCACCTAACCAGGCTTAC
CGCGTGCGTTCACGCATTTTATTAACCCGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAACAGCTGAGAACTCTCTTGGCTGATATGTAGTCTGACT
CTCTGCCTGAGGCAGTCCATGTGACTATATTCATACAGACTTCGGTTCTGGCAATGCCAGAACCGAAGTCCGTCGGGTTCACCCCTCTACATTCGAAGAG
GCTGTGAGAATTGCTCTTAATGCTGAGCATAACTTTAAGTCAGCCAGACTTGGCTGGAATGGGTACAACCCTGGTTCTGCTAGAGCAAACTTCACGAGTA
CTCCGGCCGTTAATAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAGTTGCTGAGCAGCAACGTGTTGTACGACT
GTGTTATACCTGCGGAAGCACTAAACACTTGCGGCCTGGTTGCCCTTTGCGTAGACAGCGCCAGGCTACGAGTCAACACTCTACCCCGAGCCAGAAGTCT
GGCATGGCACGGGGAAATGCCGACACCCAGTAGTCGCGGGGCGTCCTACTGGGGAAGAACTAGATTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGG
CTTAGCCCCAAAGAGTTCTATACCTACTGGTATGGAGCGTGGATACAAGTCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAGGCTTTGAAAAGCCTTGG
TCGATTTTAATGGATTCTGGGGCGTCTTGCAATTATGGTCGACGTCGTTCCCTTGAGGGAAGTCAGCGTTATGCTGAAGTGCTTACAGCGCATGAGGGTG
ATTCAATCACAATTTGTTTAGCGACCGGAAGTCGTGTCAGCGTACCTAAAGTTCCGTTGAACTTAGGTGTAAAGGTTTTGGACTTTGATAGCATTGAACG
CTGTCTTGTCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTATTGCTTGGCTTGAACGCAATGAGCCATGGATTGATTGGAGGTCGAAGACCTTA
GGCGCTACGCTCAATTTTCCTAGCGAAGTTTTGGAGAGTCATGAACCCACCTTTGCTAGGCAACAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATG
TCAATGTGCTGGACATTGGAATGTCTGAGTTAACTAACTCCAATGTTGAAAACATGAATTCCGAGCGTAGCTCGTTGAGTATTAGTGACACGGCACGTAC
TCCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGTTGAAAGCATGGTTGGCCTAGGGCCGAGTGATCAAAGATGTGATTCCTTTGATGTGTGT
GTGGTGGCACATGAAAATGCACCGAGCTCGGTCGGCCATGAAGGCACCACACTTAATGTCGGTAATGACATTCTTGGCGAAACGCCAGTAACTTCAGGGC
TAGGCCCGTATAATGTAAGTGGAGTGGCACTTTTAAATCCACTGGGTGAAGTGTTCGAGTTACGTAACACTTCACTGGATTTCGATCAGAACATCAGCTC
TAGTATAGAGCGTACTACTTCTAGTAGTAACCACAGGGACACTATTGTCCCGACCCCAGAGGGGTATGAGGTCTCATCGAAGAGACGACCTGGACGCAAG
GTGGAAACTGATAAGCGCCAGGCGTCCGAGAAGTCACATAGTGACAATAGTGATACACTATATACACTTGTCAACAGGGTAACTGGCCAGGTTGAGGGCA
ATGTTATTCTGGGAACCCTTCCATCTGTGGATGATCTTTGTGAGCTAGACGAAATGCCTGATGGCGAGTTTAGCCAGGCCATGAAGGCAGGAGGTTTATC
CGAATTAGTGGTCATTGGACCCGATGTCGAGTTGAACTCATCCTCATTGATGGATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGT
GGATCTTCGATCCTTAAATATCCTTTGGATCCATTCTATCCTTCGGTAAAGAAATTTCAAGGTGTGATGTGTCACAACCCACCATCTGTCTTACCTCCCG
ATAGAGGTGTACGTCATGAAAATGACCTAGTTCCAGGAACTAAAAAAAAAAATACTGCGTAACACGACAGTGGCCTTTACCTAAGGAACAGTGACGTCAT
GGCGATTTCTTTCGTGCTAAGCACGCGGCGGGAATAGTGCGGGAGATTAATTCTCCCCATTCCACACCTACATTTTGTGTCAAAAATCCAAATGGTAAGT
GGCGTATTGTGCACGCTTATAAAAAGCTCAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATG
TACATTGTACAGTGCGTTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATCCCGCTAACAGCGGTTAGTACCCGAGCGGTATGC
TCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCTCGGCTACTTTTAATCGTCTGGTGACGCAACTATTTAGACCTCATCGAGGCTATGCACA
AACATACTTTGATGAAATCTTTGTCCATAGTCGTGCAACGAACGGTCGATCTGATGTGAAAAATCATATCGATCATTTGCGAGCGGTGCTCGAGTGCATG
CGCACGAATACGTTGTATGCAAATGCATCTAAGTGCATCTTTGGTGCAGAAGAGATTCCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGG
ACCCCGCTAAGGTAAGGGCCATAGTCAATTGTCCGGTTCCAAAGAACCAAAAAGATATACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTTTAG
TGCGAATTACGCAGATATGGCTCGGTAATTATCCAATCTACTTAAGAAGGATGTGGAGTGGTGTTGGGGTAACACCGGACATGATGCTTTTCAAGCAGTT
AAGGAAAGTCTCCTTCATGCGCCAATACTGGATTTGATCGATCCTGATCGGCCTTTCAGTATCGTCTGTGATGCATCTGACTTTGCCATAGGCAGTGCTC
TGTTATAAAATAGATATCGATGGACGCGAACGCGTCATTACATTCGAATCTCGACAGATCAAAGCTGCTGAAAAGAACTATCCAGTTCATGACGAAGAGC
TACTTGCTATGAAGTACGCTCTAGTCAAAATCAGAGTACATCTGATTGTCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGAC
ACAGTCGCCGCATCTCTTTCAGAGAATGGCTCGTTGGATTTCATTCTATGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAGAATGCTTTG
GCTGATGCGCTATCGCGCCAACCTGAATATGAGCTTGCTCACGTCA