Description :
From Genome Similarity Track
Location :
Scaffold_975:9694- 11083
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_975-snap-gene-0.9Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_975-fgenesh-gene-0.5Transcription initiation factor IIB

Sequence
1389 bases(100 bases per row)
CGGGCCTAGAGATCGTGCTCAAGCGTCTCAACAACCGGGAAGAGTTTCTCTATCGAGGCATCGTCTGGAAATTCCGTCGTGACAAGCGCTCGCGGACCTC
ATGGCTCGAGATTTGCCACATACTCTACGAATAACAATTAGATAATCACCGCATGGGAGCACTTCAATATATACACACACAAAAGCAAAAGAAACAACAT
TGTGTGAGTGGATCGGATGATACGCCATATTATGTGGGAGCGCATGTTGGGATATATTCTTACACGGAACGCAAGTGCCCGCCACGTCGACTCTCTTTCT
CTAATACGAATGTCGCTCGTGGCACTGGTCACCTGACTGCCTGCGATCTTGTGTTCTCTATGGTCGCTGGTTCTAAATAATAATTGGTGCAGTGCACAGG
TGAGTCATACTCTTGCAAGGGTTCGAGCACACAGTGCGCACCGTTCGCTTGTTCTATCTAACGTGGAGACTCGTCGCGTCGCTTCTTCTTCTTCCATTTC
AACTTACGAGCCTCACAGGATGAGGTCTCTCTTTTCCCTATAAATATGTACGAACCTGATTGTGTTTTACTTACTGTGGTGGTGGTCTTCTGCGGGGGAG
AGGTTGTGTAAGCCATGACGCACGCGGTCCTGGATCCTCTGGGATTTCATATCTTCTTCTGTTTCTTCTCTGCTCTGCAAATCTTTCTATTGTGTCACTG
GTTGCATGGCTGGCTGGGTTGCTCGTGGCTTCTGACTGGCTCGGCTCGATTGGGTCACGCTCGTGCTCAAATGCACTCGGTGGCGATACTCTGTGCGGCT
GCTGCTTGTCTCGGGTTTAAGTCATCAGCACGCCCTCGAACAGCACCACGCGGCTCTTGTTCAGCTCCTTGCAGACTACTTTCATGTTCTTCTCGCCAAT
CATCGTCACGTCGCTGATCTCCTGGATCGATCGCTTCACGTCTGTGTACGCTGCAACCAGGTAAATCACGGATGCTGCAACAGTGATCGGCGATTTCCCC
GTCGACAAGCCGAGCGTGTCTGCTTTCTTCGCCACATCGTTTGCGATGCTCTGGGTCTTGAACGGCAAGCCCAGGCGCGAGCAGAAGCGTTGAACGTATT
CCTCGGTCGTGGGCTGTGTCATCTCGATATCCAGGCTGCGGTTGAGCGTCATGAACGACTTACCGATCCGCTTCTTCGGCACACCCGACGCTTCTTCAAA
CTCCTTCAACGACCGCGCATTTCCCGCTTTTCTGCACGCGATGAAAAGCACCGCGACCGGCATGCTCTCTTTCTCGGGACCACGCATGCTGATGCCTTTC
TTCTCTGCTTCTGCGTAGATATCCAGCGCGGTCTCCACGATGATCTTCGGCAGCGACATTGCGTCCGCGACTTCGTGCACGCGGTCCAT