Description :
From Genome Similarity Track
Location :
Scaffold_1224:9691- 11928
Transcript NameFunction/comments
Phypl_g12814hypothetical protein

Sequence
2237 bases(100 bases per row)
CATGTTTTCGTTCTGTACAGCTTGAAGCTCGTATTGGTGACCGCTACGACAGCAGTGCGTGGGTGCTACGAGGTTAGTCTTGGTGaccgcgacgacagcg
gtgGGTTGCAACGAGGCCGACTCAGACAGGTACACCCAGCGTTAGCGGACCGCGCGACTTGCTCAAGGCGTCGTTGCTGACGTGCTGTTTGTAAAACATT
TGTCCAGTTAACGTAATGAAGAAACGAAGTGTTCGGCCGACTACAtatgacgatgaagatgatgattTACTACGACACCTAGATGTTGCTTTCAAACGCG
AGCAGTGGAAAGAAGAGAAACGAAGCTTAAGAACTCGTAAAAAGATAAAGAGTGATCCGCGAAAGTTTTTGAATCCTGTGAGGAGTGACGATCAATCTCG
CTATATACGCGATCTCCGAGAGGTGTTGGGTGCCGAAAGATTTGATAAAAGCGTATGTAGAGCATGTGATCGCGTGACATTTGCGCGGGACATTGTGCGA
AAAGAGGGTGGTGACTGGAGGTTTATGGACACGTAAATCACGAAGATGAGCAAACTGTTCTAGAGCGGCGAGTTATGTTGATGGACGACACGTCACATGT
TCCTGCGTGCGAGAATCCATTTGTTGCTGAAGTTGGCAATGAGATAGGGTTTTCATGGTTCAAGGATCAAGCACCCTTTCTAATGACTTAAACGGAGATT
TGTTCGCTAGACTGTTACCTCACTTGTTACCTTTCGGACGTGGTCACCCTGGAGAATCACGTCGAGTCGCCGTTTCATTGAAAGGGGCCATTAAGTATTA
CATTACGTTGAGTGGCAGACAGTTCGCCGAAGATGAATTATCCATGCTGGTGGCATTTGATCGACTTTCATTACAAAACATGTACATTCAGAATTCAGTG
AGATGTAAACGATTTCCCCAGTTGTTCAGCGGTTCGAAAACATTGGAGTTGAGCAACTGGGTCACGTACTAGTTGTCACGGCATCTGATGACCAAAAAAC
TGAAATCCGCCGCAAGCTACGCGCACAGCGAGCTAGTGATGGAGGCAAGCGAGCGGTGTCCCGGCTAAAATGCCTGTGGGAATGCCTCCCATCGGGAGAA
AAACTATCCTGCTCAATGGGGTACTTGCCGTGTCTTATTGTGCTGACACTGGTGCAGACAGAACAGCCGCCAGCCAACTTCACGTGGCAGAGCTACAGCA
ACGTGACACGTCCGTCACAGTGACGCATCTGGACGTCCCTGTCGTTAATGTGACCGTGGGTGGTCAAACGAGGTCACTTGTGCGCGCTCAGTGAAGCTTC
GACGGCAGCTAAATACTGCAGCCGGACCAGTGGGTTTGCACGAGCCAGTCGAATGCCTCATCATTGAAGATGACGAGCCAGAATTCATCCTGGGCCAGGA
TGTGCTGAAGTCATTGGGCATTGACATCGACCAGCGGATTGAGCAACTGGCCGAGCGGATCGATGACCCTGACGATGGTGAGGCAGAACTGAAGGATGAT
CTGCCGGGTTTAGCACCTCCCTCCACTGATGAAGAACTACGAGCGTCCCTAGACCGTTTAATTACGGTGGCGTTTGAACACGGTTTCCCACGTTGTCTAG
AGGAAAATCTCCGAACTATCTTGCACAAGCATGACATCTGgcggctcgagctcggcAACGACCCACCTGTCAAGGTTGACCCGTTGAAAATTAGGCTCAA
ggaaggaggtggagcagtCAAGAGCAAGCCTCGTCGATACCCACCGGCTGTGCGAGCTTTCTTGCACGAGTTCAACAAGAAGTTGGTGGAACTTGGCTGT
ATTTATGAAAACCCCAGCAGCCGTTGGGCCAGTCCGGTGCTAAAGCGGGTAGTATTGGCGACGAGTTTCGCTAAACCTGCGACTGCCGTCTAGTTAACGA
CCTCATCGAGGCTCTCATTAGCACGATGCCTCATATGGTGACCCTGCTCGAGCAAACTCGAGACAAGGAGCACTACGGTCTATTTGACCTACTCAAGGGT
TTTGGCAGCTACTTTTGGACGAATCTAGCCAGGAGCTAATGTCATACATAACTGACAACAAAATATACATTCCACGTCGTGTTCCTCAGGACGGGTCTTA
ACCACTGCCATGAGTGCCATGCCATGACATCCTCGTCACGTCGTTACGGCACGGCTGGCAGTTTTCCGTTAGGAGTAAAAACTGCCATCGAAATGTCATA
CGGTAATTTTACGGTATAATAATAAGTTCCAACTAAA