Description :
From Genome Similarity Track
Location :
Scaffold_6:96906- 99253
Transcript NameFunction/comments
Phyta_totarag457hypothetical protein

Sequence
2347 bases(100 bases per row)
GCTCATATCGCTGTTGGAGGAGCGCCGCATCTGTGGATGCCCACCTCAACTCACCGTAGGTAACACCGAAAGTTAGCCTCGACTTTTCGGTGGTCGAAGG
AAGCGGACACGTTAGCAACAAAGGATGCCTTTCAGCggacacagcagcaaattgcaAGAAAATTTGGATTGCCTTTTTCTACATGTTCGAAGTGCGCCAA
AACTATCGTGACAATAAATATTCAACGCGCCTCCCTACTCCTCCGATCTGTCCCCGCAGCGAGCCTCAAATGTGCGTGGAGTTGGTGGAAGTCTCCTATG
ATTCTCTATGCGCAAGCTCGCAAATCGAGCGGGGACTACCATCATCGTTTCTCAGGGTTCTGCAAAGCACCAATGTTGGTAGCTTGATGCACAGAGCACA
CGTTGCCGTTGCGCTCGTAAGCAGGCTTTCGGCATCCTTCCACGACGCATCGCTTGCCTGTGTATCAAGAACAAATGACAAGCAACAAATACACAACGAG
GGCAAAAGCAACAAAGCGAAGGaaagaagctccagcacgtgaGTCCTAAAATGCCAAGGCTTGCTAGAAAAATACACAAGTGATGCAGCTCACCTCCTCC
GTGAGCCCAGCAAAGACCGTGGGAGACTGCCGTCTTGGAGCAGTTTTCTTCGCTGCATTTGCGGCCTGGTGAACGAAATTTGAGTTAGAAAAAAAAATAG
CTCAATAAAATggatcagcagcagttcccGTACCTCCGCCGTGAGACCAGCAAACTCCGCGAGACTTGGCACGGTTCTCGCACCCAGCCACCGTGCACTT
GGTGGATCCACCTACACATGTTAATACGCAACGTTGCATGAGCAAATCATGAAGCCACCTTTTTTTCCGAGATCGTGTCATCCTTACCGTGCTTCCAGCA
CACGCCCAAATTTTTAGCACTGCTTGTGCACCCCACGATAGCACATCGCTTGCCGCCCTGTTATCAGGTTGTGTATTTGCACAGATGTTCATTCATCAGT
TCGATCCCAAAGGACCAAAAGAGCGACTACAGTCCAAAAACTTACGCCGTGACCAATACAAAGTCCACGGTTCACCACGTAACGCGTGCAATTCTCAAAC
TTGCAGATGCGCGACTTTTTCACCGCAGCTTTCGGTGCAGCgacagcaggagctggcacgTTCGCAGCTCTGTTCTCCGCCGCGCAAACACTTGAACCAA
CCGTGAGATCAGCTGCAAACGCATACAGtacagcaagacgaagaaggaagcCAGCAAACACGCGATCAGTCCGTGCAAACACGGAGGTCGATGTCTCCAT
CTCTGCAAATCCAGACGAAGGCTTTCTTCGTCTACAAGGTTCATTGTTCAACGTAACGTAACGTACCGAAACTCGGAGCCTGGTCCTCGTCCGCGTTGCC
CCCTAAAATGAAGGCGAGCGAGCTCTTACTGGCTGCAGTCGCGCGCCCCACGAGCGCCGCAGTTGCAGCCGCAGCGTCGTCCGTGTTCATGATGGCTGCC
AGTCGGTGTCTGTTTGCAGCGAACTGCAGCGTTGGCATGGCTCTGGCATCCTGTCCGGACTCGTCGGCCGCTTGCTGTAGCATCGCTGCACtcatgtcga
cgtcgtcgtcgctggccgAGTTCTTCATGCAGGAGGGCGAGGGCTTGGGAGGGtcaaagagcagcagcatccacgGGGCTGAGATAGGGAGGGACCAaag
ggggaggaggaggacgcacGACACACACACGCGCGCCACAGTACTCGGCTGCGAGTGAGCGAGTGGATGTATTTATATTCCTAGTGTGACTGACTGACGA
CTGCCAACTGTTCCGACAGCCAGCGCCAGCCGCTTGTTATCTGAATAATGGAGCGGGTCTCGCTGACACTTCGAGAAGGACTCAAGTCGCGTCTGTATAG
CGAGCCAGAGAAAAGACCAACGGTGGTGATTGCTTTGCGCTGCGTCACCGTAGCGAACCACTGGTGTCCGCGTACGGATCCGCTATTGAGCGCGATACGG
TACGCGTCCGACTTGGACTTTGTATGTGGGCCCAACGGATGGTGGAGCTTCGAAATCCCGCCCCCTCATACAAAAAACAAGTGGTTTAACCTAGGATCGC
AGGATCGGGCTCGTCTCTGGCAGTCTTCGTGACGTAGCGCTCCGGATCGCTGCAGATGCCCAGTTCAGCATGACAggctcttcatcttcgggCTGGGCTG
GAAGATGGAAGCTTTGCTCTCTCTCTGCCTGAAAGCAAGCGAGTCGCTTGTTGAATGCTGCATTTCGATGCCTGCATGGGGAGCCACTTCACTGCGTTTG
ATTAGCCGAACAAGATTAGAAGGCACCCATAATCGACGCATAGACAC