Description :
From Genome Similarity Track
Location :
contig_4:969- 4036
Transcript NameFunction/comments
g1271.t1OWZ06963.1 LOW QUALITY PROTEIN: reverse transcriptase [Phytophthora megakarya
g1272.t1hypothetical protein

Sequence
3067 bases(100 bases per row)
GAGTTCAGCGACATCTTTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTG
TGACGCGGCAGTGGCCGCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCC
GCATTCCAGCCCGACGTTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACG
CCGATTCCGAGGAAAGACATGGTGCTCGACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCG
AAGCCGACGTGCCGTTGACTGCCGTCAGCACGCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAAT
CGCATGGTGTCAAATCTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCGTGACGGACG
TCGAGATGCACCTTCAACACCTGAGGCAGGTGTTCGAAGTGATGAGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATC
CCAGTGCTCGGGAGCTACGTCAGCACAGAAGGTGTCCGTGCTGACCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCT
CCGGCAGTGGCTTGGCCTCGCGACGTACCTCCACCACTACTCGAAGAACTTCGCGGCAACGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCG
TGGTCGTGGCGTCCTGAGCACCAGTCGGCTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCA
TGTCGTGTGCGACGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTG
AAGCCGGCAGAGCGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCT
TCGCGATCTACACCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAA
CTTCGTCATCCACTACAAGCCGGCAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGGTCGACACGCAGTTGGCGACG
AGGATGACGACGAGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGA
GGCGGACGCGCGCGTGCTCCGAGATGATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCG
ATTACCAACTGGAAGGAGGCCTGCTGACATACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGAT
TCACGAGTTCCATGACGCTCCCAGCGGCGGCCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGG
GTGCGGAAGTGGGTACGCTCCTGCGAAGCGTGCCAACGAGTCAAGCCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCTCCCAGTTGCGGCGGATCCGTG
GTCTTCCGTGAGTATGGACTTTGTCTTCGGGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCAT
CTTGCTCCGGTCGCTGTCACCATCACCGCGGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCGACCTCGATCATCTCCG
ATCGCGATCCCCGCTTCACCGCCGCATTCTGGACCGAGCTCTTCAAGCTAGTGGGGACGCGGTTGAAGATGTCCACCGCGTCACACCAGAGACGGACGGC
CAGACCGAACGCGCAAACAGGGTCGTCGAGGACGTGCTGAGAAGCTTCGCCACGTCGTTCGAGTCGTGGAGCTCGTTCCTGCCTATGGTTGAGTTCGCTC
TCAACAACGCCGTTCACACGTCGACCGGTCTCACGCCATTTTACGTCAACTACGGTCGCCATCCCGCGTTCCAGCGCTCCTCGGCATGGAGCGCTCGATT
CCCCAAGGCGGCGCTGACGACGAGAACGACTCGGCGCACCTTCCCAATGCCGACCAAGTGCCCAGCGGCACTGAGGCCGCTGACGGCGCTACCTCCGCCT
TGATGAACGGTGTCACGACTCGGCACGGTGCCCGAGCCTCAACTCGAGGCATGCGTACGCGTGCCGCCACGAGGGCGGCACCATCCGACATCGCATCTTG
GACACGTCGGACGCTGATCAACCCACGTCAGCGTCCTCGTGCAATTGCATATGAAGACACGTCCGGCGCGGCGACCCCGCCCGCGCCGCCTCCAGCAAAC
TTTGACCCCATTCCGTCCCCACAACCGCGCGACACAGCGGCTGTCAGCAAGTTCTTGCAGCGACGCCAGAGTGTGGCGCGCTATGTTCGTGACGCGATTG
CAGTGGCAGTCGATCGTCAGAAGGAAAACGCTGATCGACGCGGCCGCAAGAACATGGAGAAGTTCGCCGTCGGCGACCGCGTCTTGCTATCGACGTCCGG
CATTCAACCCATTTTGGTTACCAATTTGGGCGCGAACAAGCTCGCGCCAAGGTATATTGGACCATTTCAAGTGTTGAAAGTGTTAGGAGATGCCTACACG
CTACAGCTACCTACAGCGCTCCGGCTTCATCCTACTTTCTACGTCGGTCGGCTGCGGCGATACCATC