Description :
From Genome Similarity Track
Location :
Scaffold_201:9689- 14956
Transcript NameFunction/comments
Hyaar_Emoy2812463AlNc14C264G9866

Sequence
5267 bases(100 bases per row)
CCCGTTACACCCGGTAGCACTTTCTAGTCCGTCCGACGATTATGAACATGTTCGATGATGAAGCGGAGGACTTTCATCCAACGCACGAGAGCTACTCCCA
TTTGAGTCAAATACAATGGGATGCCGTCGAACGTTTGAGTTCGAAGATAGGGCAAGAAGCCGTGGCGCAAGGCTGTCCGCTCTGGGCCCAGACGGGCAAC
ACGCCACCATCGCCATGTTCATTCAACATGATTTTGGCGCTGAACGGAAGAAGGCAGCCTTGCTTCACCAACAAGGGTCTCAACAGACAAAGCTGTTGAG
AGAACATAGTGCTCAACAGTTTGAACTGTTGAGACAGCAGCAGGCCACTGCTACCGGGTCGACGTATACACGTCGAACCGAGACTCTAGAGATTGACATC
TCAAAGTACAAGGGAGCCGATGAAGACTCCCTATTGAGGTGGTTCGTGGAACTAGACGATGCCACAAGGGCTCGTCATATTGTCGATGAGAAAATGCAGG
TCGCACTTGCTCAATCGAGTTTGGCAGGACGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGAATGTCTTCAA
GTCCCTGCTAAGGCAAACTTTTGAGCCTCCGCGAGCTGAGTTCAGGGCTCGCTATGAACTCCTGAAGATAAACAGGTTAACGTGACGTACACTCGTACAT
TCAGTACATACGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACCAACAAACGTTGATTACGTTATTCATGCAGGGTCTGACTGATGGTCCTGTT
AAAACCTACCTGTTCCGATTGGAGATCAACACCCTCGAAGAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGAAACAGTCTCACGCGAATTCGAAT
TCCTATCGTCCATCAAGACGACAGGAAAACGGAGGCCCAGAACCGAGGGACCTCTGTCACGCTGAGAGTGAAACCTCTCGCTTAACCAATTATAAGAAAT
TGCAGACATGCAATAGATGTCAAAAGACAGGGCATTATGTATACAGATGCAATGCCCCGAACGCGGTACCACGTACCGCAGGAAACAGTAACCGTCAAGC
GGCCAAGAAGGGTCCGAGGCGTGGTTCCGACGCTGTTGCAAAAAGCAACAACGTAACGGACAGCCAAAAAACGGTCAGGGTCAGTAAGTGCGGAGCACCC
TACTGATCCAGCAACGTCAAGTGAGTTTGCCGGTCTCTTGACGAAAGTTGCTCCCAACAATCAGTCATCGTGTGTTGCTGCTTCTGGTAATGAGGTTTTC
CTCACTACCTTGAAACTCGAAGTGACACAAAGCATGTCACTTCGAGACCTAGTCGATTGTGGGGCGTCGAACACCTTTGTACGACGCCAATCGCTAGACA
AAAGAGATCTCTAATATGTTGAGCGAGAGATCCCTCCAACGACGATGACGGTGCGCCTAGCGACAGGCGCATCGGTAACAGTGATGAAACGTGTAGTAGG
AATTTCCTATAAACTGAAAGAAGTCCAATACGACGATGACTTCATCTTATTAGGCTTGTATGACAAGTTTGATGTTATCGTTGGACTGCCGTGGCTCAGA
AGGTACGAGCCACAAGTCAGCTGGATCGACGAAGTGTCGATATGCCCGCCGCTCGTTCACAGACGGCCATCTGATGAACGCCATGGAGCGTCCACCACCA
TGTGGGTGTACTACGAGAGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTGGTACGACTGCACAAGATCGCAATATAACTAACCATCATATTGTGGAGC
AAGTTCCCGGCGACTGCATAACAATGCAGGAAACGACAAAGGCCCACCACTCAAATAAGTTGATCGGACCGGGGCATGGTTATATTCTTAGTGGACAACT
CCGAGATGATAACCAACTGATTATCAACGATGGTCAATACGGAGATTAAATAGCCCAAGAGGCTAGAGGTGAGGGAATAAGTCCCCAACGAACAGTGGAA
ATAAGTTCCCATGAGATAACAGAGACATTGAATTTCCTGGTTAATGACATACCAATCATAGGAACATACCAACTTAATGCGATCGCTCCTCCGAAGACAA
CTTCAGCGATCATTCAATTGCCCGCGCTCGAACAGAAGAGGTTCTTGCGTGATCTGTGTAGTAGCAAATTCAACCAGAGTTGCGTACTCGTTGCGGCAGA
CGAGCACGTAACCGATATTCAATCGGCAATGGTATTCCCTGAGAATGAAAGGGTCCTCAGCAGCTCATCAATGGACGAGAGTGTCCTTGACGAGAAGACT
CGGATTGAGCGATATACATCCCAATCGTGGGAATCACTTATAACAAATCCTCTCTACGATGATTTGATGGAATTCAGGGATGTATTCCCAGAAGCAGTCC
CGTGCGGGTTACCTAAGGACAAAGGTACTCGTCACGAAATCGACCTGAAACTGGGTTCGAGGTACTGTTTCATGAAGCAATGGCTACTGCCTCGTGAACA
AGCACTAGCGATAGACAAATTCTTTGCAGATTGCTTAACAGCCGGTCATGTGAGGGAATCTACTTTCCCACATAGCTCTCCGACCTTCTGTGTCCGAAAG
GCCACAGGAGGATGGCGGATAGTACATGCCTTCAACAAGTTGAGTGCTGCCACTGTACCAGCTCAAATACCAATATCAAGGTGAGACGTCATCAAAGATG
GTATGGCAAAGAATACCATCTTTTCATCAATGGATCTGATGGACGGGTTCTATCAGATCCTTATGCGCGAAAAGGACATTGCTTATACAGCAGTGAGCAC
CCCAAGCGGTATGCTTTGGGAGTGGTTAGTAATGCCACAAGGACTGAGTAATTCCCCTGCTACTTTCAACAGATGCGTTACGGATCTGTTGAGATCTGTG
CGAGAATTCGCACCTAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGACAGACGGATGTGGAAGTCCACCGACTCCACGTCCGAAAGG
TTCTTACACTGATGCGTGAGCACAAGTTGTATGCCAACCTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGATGCATCGTGGGTAAGCA
CGGCTTCCGGCCCGATTCGGAAAAGATCAAGGCGATCACTGATTGGCCGGTGCCTACCGACATAAAAGGACATGGAAAATTCCTTGGCCTAGCGGCGTAT
TTGCACAAACACTCGCACAATTACGCCGAGATGACCGTTCATCTCTCTCGTTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGTCAGCGCT
CATTCGAAGGTATCAAGCTTTGCTTGATACGTCGCCGGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCAAGTGATTTTGCC
ATCGAATGTGCACTGATGCAGTACGACACAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCACAACCGGCTGAACGTAACTACCCCCCCCCAGT
CCATCACAAGGAACTCCTTGCCATGAAGTATGCTTCGGCAAAGTGTAGGATCTACCTGCTAGGCGATAGACCCTTCATCGTTTACACGAAACATGCGTCC
TTACGCACGGCCGTTAACAGTCCACACCTCTCGCAACGAATGGCGAGGTGGCTGTCGTTCTTTGCATAGTATAACTTCTCCGTGGAATATAAGCCAGGAC
GACTGAATGTCGTCGCTGATGCTCTGTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACTGGTCCGACGACTGTCGCGGTGTTGACGTCGAG
TGTCCCGTCGTCAACCTTATTCGAAGCCATACGCAAAGCGTACGATCCGGCGATGGTTCGTTTGATGGATCATCTCTCGTAACCATCCCGTCAATCCCTT
AAAAGGTTGTCCCCAGTATATCGATCCTCCACGGATAGATATACAGTCCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGCGACACGCCTCGTTTCG
TCGTACCGGACCATGGTGACTTGCGACTGCGCATCATGTATGTGTACCACGATGCACCTACTGGTGGACATCGTGGTAGAGAGAAGACACATCTCACAGT
CAGTCGCGACTTTTACTGGACCCGCCAGTATCAGTTCGTGCGAAAGTACTTCCGCGCATGCGAAGTATGTCAACGAGTGAAGTCAGGTCCTTCACTTCGT
GCACCGTTGCAACCCTTGCCCATTCCGGCAGAGTGCTGGGAATCAGTCTCAATGGACTTTGTCTTCGGATTCCCCGCAGACCCACACAAGCATACAGGTA
TTCTTGTGTTAGTTGATGGATTCAGTAAAATGGTACACCTGGTCGCTGTACCTGAATCTATCAATGCATCGGCATGTGCTCATGTCTTTATTGACACAAT
CTTTCGTCTTCATGGATTGCCTCGTGAACTCGTCTCTGATCGAGACCCACGATTCACTGCGGAATTCTGGCTATCCGTGCTCAAAAACACTCGGAACACG
CCTTCAGATGTCGACCTCTGAACATCCTGAAACAGATGGTCAGACAAAACGTGCCAACCTCGTTCTTGTGGAAATCCTTCGGGGTTATGTCCATTAGTTT
ACGATTGGAGCGAATTCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTGCGCCA
CCCACACCTACCCACCTTCTTAGAGTGTAACTCTAGTTTGAGGGGGGGAGGGACTCATTCGAGTGAACGCCAAGTCGGCTCTCACTCATCACGTACTGAC
CACGAGGTCACTATTTATGACGCCGATGTCGATCACATCGACTTCGGAGAAGAAGAGGAAAGTAAGAGCGAGGATGCTCTTACTACCCAGGTCAATGATC
TTGCCACAGTACGCTCCAAGCGCACTACAGGCAAATACAGCGAGTCAGCAGACGAATTCATACTGAATCGCGAAACGGTTGTCCGTTTCGTGCAAAATTC
CATTGCAGAAGCAGCGGACCGACAAAAGAAAAACGCAGACAAGAATGGAAGGGCAAATGTTCTTTCACTCAAAAAAGGTGACCTAGTCCTACTATCAACG
GTAAACCTACCTCGACACATAGTGACTGACGTGGGAAGTAACAAGTTACTACTCAAGTTCATCGGTCCAATTCGTGTGCTGCACCGCCTAGGCAACGCAT
ATATGATTGAACTGCCACGTAAGATGCACACGCATCCTACGTTCTACGTCGGTCGCCTTAGGCCGTA