Description :
From Genome Similarity Track
Location :
Scaffold_195:96888- 100155
Sequence
3267 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNctcaaaatcactcggcgcaacgtttgtgaggtcgagctgattagtgcttgtaaaatacatcggtgcctcgtcaccttt
agttgatcgaatccatcgacatataactgccaagctacctcgatacgcgcgctgtgttttggaagatacgcatgcgtcccttacgttttgcacagtgatt
tcacttgttccactcccattttgtgcagcagcccaagtcgacggagaactggtcgattggggggaggacgatgcctccaagctggtggctgaaggaaaca
cgtcaccgttgtacgtcgaaggtgctgaagatggactgctcgacagtggggtacgaggagagacagactcaacggagaccggggccatgatggcactcgg
ggccaagctggacttggtggcgctcgaggtcaagctgggctcagtggtgggcggagccgagccgctcttggaggtagacagcggcgggctgggtgtgctc
gaagacaggttccccttaacttgcttggtcgcggtgcaggtcgtcatgatgcaggagggataaacttgacggcgtgaattgttttgtaccaatcccagcg
agtcggatgtgtggccaacggaacccgtgccactcgttcgcctctgtgagtgtatacaaatgtctatatgttcatttacgctatgattcacatttttgtc
gatttggccgcgatatttcctacgattacatacaaagtgccatatacggcctacgtgtcaccgacaatcTGGTGTGGTGCTCGGTATGGCTTATGTGTAC
GATGCATGATATTTGCGATTTGACATGTTCTGTGTGTCGAACCATATTTTTGAGAGTTTTGCATGTTCTGTCGCTAAAGTGACGTTCTCCTGCCACCAGT
GCGGTGGTTGGTGACCATGAATCGCCGCAACGGTTCGAGATCTGCGGTTAACCCTACATCCACGTAAAATTTGACTGTCTAGTATACGGTAGTGGAAGGT
GGAGTATCCTGGAAATGGATACCGctatttccgggagcaataggattcaaggacgcgctgtctgcgaccaaggtcagcatgagatcaatcatctacatgc
gatcgtgctcttccatgcttaagatagacataagtagtgctagcgaggcggaggaactgaccgcccactccgggttttcctccgcgccgttaaGATCGAC
CCGCCTCACCGCGCCCTCGACTCACTGCAATGCACTACATTAGCCCCAATCCGGTTGCGTGAAggaaatagattaggttaatccgcaaaacgttgacgaa
aacgcttaaaggatctctcttttctacgagtccgattttatcgcgatgtgcgtgttctcccaagaaagacgtgtctctaccattagtttgcgcagtcagg
ggtgtgtcaccatctactgagtatcctggtgggtttatactcggactgagtaaatcggtcccagtaaaagatccagtttttgaacagaaaacgccgaaca
tggaaagTAAGCAATGATTACTTTACATGTCATGTAATCTTCCCATCTACCATTCCGTGTGTACGATACAATAGACTCTGAAGTCGAACATTTCGTTTTG
TCGTAGCGTGGGGCGACACCGCTTATATAATATATAGGCGGTGTCAATATTATTGTTCTATGCATACTGTATTACTATACAGGTAATGCATGCTGTCCCA
GTCGAAGAGCAGATCGCATGTACTACATATATCATAGATACACTGAGAGCATGTACATTGGCCGCACAGTGACCTCGCTCGCCGTAGCATCATTTAACAA
AATTCGCTCAGATACAAAAATGAACGTGATGCTAAGTTACTGACACAAGCAGATGCCAACGGAACGTCGAGGCCAGTGGATACACTTCACGCTACAATAC
ACACGTATCTGTACATGTTCCTGTACGGGTATCTTCGCAGAAAAAAAATGCCGTTCACAATTGACGAGCAGGAGATTTCAGTCGCCTGCAACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN