Description :
From Genome Similarity Track
Location :
Scaffold_394:9685- 10688
Transcript NameFunction/comments
g17768.t1OWZ15959.1 reverse transcriptase [Phytophthora megakarya
g17769.t1RAW24820.1 Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Phytophthora cactorum

Sequence
1003 bases(100 bases per row)
CCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGAATATGTCGAGAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCCGA
CTGACAATACATGTGATCTTCATGACAAGCTTACCGTGGTGATCTCCAGCCTCCACCAAGTCGACGAATATTCGTGATCGGAAGTGACGATGGCCTTGGA
TCTCTTGCATGGAGAATCCCGAGGATATTGGAAGTATCACGTGCCAGACAAGAAGTTTCGCCAGGCGAAAGCCGTGGGGAAGATCAACAACGAAAAAGCC
ACTCTGCTGTTTGACAGTGGCGCCGAGGTGTCCATTTTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACATAGATAACAATCAGGAGTTGGAGTGTG
AGGGTGTTGGCAAGAATCCCTATATGGCGGAAGGACGTACCAGAATCAAGATCACGCTCGCGTGATCGCTGAAAAGTTGCTTTGGTCGGTTGATGGCAAA
ATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCG
GATACTGAGTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAGTCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAAC
AGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTGCCACTGAGTGAAGGTCATACCGGTATCCTACCG
GTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAATACTCCCACTCGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGGTCCGAAGAACTTCGAAC
TGTACTGCAGTGATCGCCTTCGTCATCATGTCCGCCAGCATGTCGGTTGTCGAAACATACTGCAGCACCACTTGGCCGTCTTCCACCTTCTCGCGCACGA
AGT