Description :
From Genome Similarity Track
Location :
Scaffold_922:9684- 11256
Sequence
1572 bases(100 bases per row)
TTCTGCTTCTTGCTGGGCGAAGCCGCCTTTCTCGAGCCGCCTGCGAATGCTGAGGCTGAGCGCTTGCGTGGACTGAGCGGCTTTGCGATCTCGCAGCGCT
TCACGCCGCTGCTGTCGGAGGCCTCGTACGAATCCATCGCGCAGTTTGCCGTCGAGTACACGCCCGCGGTGCTACCCGTGACGCGGGACGACATGAGCGA
TCTCATGAACCGCTTTGGCTGCATGGACCACAACATCATGCACGACGTGGAGAAGTGGGGGTTCTATGGCTTTGCCGAGAGCAGTTTTCTCGTCCACGAC
AAGGACGAGGACCAGGAGGACGGCAATGGCGTGACCACGGCGAGCGAAGACGAAGTGCGGTATTGGCTCGAGTTTGCGCAGACAAGGGCCTGCAACCAGT
GCCACACGTGGCAGGAAAAGCTGCTGCGCTGCGGCCGCTGCGGCCACGCGTGGTACTGCTCCCGCGACTGCCAAAAGACGGCGTGGAAGCTCCACAAGCG
GCTCTGCGGGAAAAGCGACGACCAGATCCGCGCCGAGTCGGCCGCGGCCGATGCCGCCGCCGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNACTTAGTAATGGACAACGCCTTGTGCTGCTTCTATTCGGTATGCTATTTGCGTGTCTCGTGTCCCGGTCTCTCTTCTCCTCTTACTACAGGTTGT
CGTCTCCTCCACGGACCCACAGTCGCGACAGTTGATTGTTGAGAGTCTCACCCTGCGGTTGGGTGGGACATGCCGCGACCGTCCCAGACGTAGTTCCTGG
AGAGGGTTCCACTCCGCTATTTGCAAAGAACTACTCGTCGCATGAAGTCCCGCCCAGGCCAGCCGAAGACACCACGTCGCTCCCACCACTCCGATCCGTC
GCGCCGCCCCGCGCAACGTGGTTTGAGTCGCTTCACGCCACCCGGTTCACCGCGTCGCCCCTTACCACGCGGGTCGAGTCTCTCCAGTTTTTCACCGGCG
CTCGACGCGAACGACAACTCGTCCGACGGTGACGACAATGACGCTCAGACCGAAGACGACGGCGCCTACGAAAAGGATCTGGTTGGGACTGGTACGACGA
TGACGACCATGTGGACGGGAAATTGCAACACGCATCACTGCCTCCTGTGCACGAATGAGTACGCAACGATCAACCCAAGCCACTTCAAGCTGCACCTCGT
GAATGTACACCTCAACAAAGACCACTCCAAGTACATGGAGGGCCCGCTGGTCAGTTTCGCGCCACGTCAGGAAGCGACACCTACGGAGTTTGCCATGATG
AAGAGCTGGCCAGGTTTGCTGAGTCGTTTGGTGGGGAGATTCGGTAGATGCTCAGTTCACTCCAAGCGGAACAGGAAGGCACGCCACTGTCGACGCCGAG
CTCTACAGACTAGTCACAGACCGAGAGAGAAGCCTACGGCGAAAGCGACGGAGTGGCGTCGCCGCTGAAGCGCGGTCGAGAAGGCGAAGACCTGGTCTAG
AGTCACCCGAGCTTTGCGTCCAAGAAGGCGAAGACCGATGCGGCAAAAAAAAGGGAGCGAGCCGGGGCCTGC