Description :
From Genome Similarity Track
Location :
Scaffold_862:9682- 11583
Sequence
1901 bases(100 bases per row)
ACGATCTAACCGGCTACTGGCTACATCACGGTGTCACGATCGGCGGGAGGCGCCGGTCGGAAGGATACGGTTATTTGTTTGTGAGTGAGAAGATGGTATA
CGCAACGGgACGGAGGCATCACGTGATAGGGGTGGCTCTACTCGAGGAGATGTTCTCGAGCATCCAATCTTAACACTGGCTCGAGTCACGGGAGCATGGA
GAATTGAATGAAGAGCACGGCAATCAGATCATCAATATTGGACCATGTTCAACGGGCAGACAGAAGTTCAAACGCTACGTATGCAGGCCACAGCGGGGCA
ATCATATAGGGGCGGGCGCGCTCGCCTCAACGCGATCAGCACTCGTGCTGCCCTCGGGTTCGCCGGTCGGGGTCGAGGTGACGGCACTGACCGCATCAGG
AGATGGCGACACTGGAACAGATGAGCTCGCGGAGCGAGCTGGACGAGCTGGAGATATCGACAAGTCGACCACATCAGGAGTACCTGACGGCTCGTCTGGA
CGATCGTCCTGCTGCGCTTCGAGGGAGGgCGAGGTTCATCGTCCGAGTCCTCGTGCTCCTCCTCGTCTTCAGAATCACCACCGCCAGGGGCGTCGCTGAC
GGCTTCAGTCGCGTTACCtGCGTCAGATTCACCCGAGTGATCGTCAGTACGACTGCCATCACCAAAAGTTGGCAGGCTCGGAGATCCAGCCGGCAGCGGC
CGAAGCTGAACATCCACAaCaGGTGATAGCGCGGCGAATTTACGTTCGATCTCGGCCAAACGATCTTGATCCAAGCCGATTGCCTCGATAAATGCACGAT
CACCTCCAGGTCCACGGAAGTACAGACGGCCAGGTACAGCTAGATCGGCTGCCGCAACCGCGTCCGCCAACGACTGATGGAGCTTGGGTGCCACGAGCAT
CGCACCGTAGACCGGGGCCCAGTAATGGAACGGGTCCAGGAGGAAGTCCGCGTCTAAGCCAGGGTACTGGGCCAACGCTGACAGGCGACATAATGCTTGA
GCAGCGGCTGGGTAAGCTTGGAGTTGCGATCACGTCGCTTCTTGAGGTACTCAGACGTGGTGACCACGTCCCGTCGAAGCGAGCAAGACCATCGGCGGCT
GGGATGAAGGCATACGTTCGCTCCCACAAGACGAGGGCATGCTTGCGGTAGAACTCCTGCGCGTCTTTGACGAACCGGGCCAGCTCGGGGAACCGATCAT
CGTGTGGGAACTGGGGCGTAGGCGGCGAGGCGATGACCTCCCATGGTTTGGAAGCATAGACTTGGGCGATCTCCTTCAACGGCACCTGATAGCTCTCAAG
ATCTTCAACGACCGTCGAATAGGAGCGAGGGTCAGGGACGACTTGCTCGGTCGTCAGAAGGGACAAGCGCCACGCCATCTGCCGGATCTCCAGCACCGAT
GCCGGAAGATCCAGGCGATGAGGAGAACCACGCGGCCAAGCAGGTGTCGGCGGCAGGCGATCTGCCTTGCGGGGACgCTTGATCTCCAAGGCtCGCTGCT
GTTCACGAGCTCGTGTCACGGCTTGATAGCGAGCTAGGCGCTCCCGCGTCATCTTGTGGTTCGTCTTGGAGTTGTTGGGCGATGCTGCACGGCGTTTGCC
GCCCTTGGGCGCCTGGTGAGACGTGGAGGTCTGCGACGGCGTCGGGCTGGGCAACGTCTTGCTGGATGACGGTCGGCGTGGCCGGGGAGAAGGTGGAGGC
AAGCTCGGTGTAGTACTACCAGTGCCAGCACCTATAACATGAAGATCAGAACGAGTCGTGGTGAGGGTGTGAACAAGACGTACCGCTGGGAAGATCGGAC
GGAACTTGAGGCGAGGGCATTAGCAGGGATCCAGTTGcacgcACCagccgatcGTAGacatcCACGatgtccACgtcattGAagacGGCgtcacggaagc
g