Description :
From Genome Similarity Track
Location :
Scaffold_1101:968- 2528
Transcript NameFunction/comments
Phyag_g9491hypothetical protein PHYSODRAFT_516060
Phyag_g9492hypothetical protein PHYSODRAFT_518156

Sequence
1560 bases(100 bases per row)
CATCGGCGAATGGTGTATGGGCAAGGGTGGTCGCTACTTAGTGGTCGTCTCGCAGATGGGCGTGTGTCTGCTGGTGCCCTGCGTTTTTCTCGTGTTGGGC
GGCTCGCTACTCGATGGTCTCTTCTCGAACGCGTTCGACCAGAAGGTCTGGATCGTGTTGATGGCGCTTATGGTGCTGCCGGTTTGCCTCATTCCAACAC
TGAAGGAAGGAGCGGGCGCCGCTTTCGCCGGTTGCGCAGGAACCATTATGGCCGATTGCATCGGTGTTACAGTCGTCACACACGGAATGCGTGGCCACCC
GAGTGTCCCGGGGCCTCAGATCTCCTTCTCGCAAGTTGCCAGTGCTTTCGGAAACCTGTCGCTAGCTTACGGAGCTGGTATTGTTATCCcggatctgcag
cgtcagcacagTGACCCGACTCGTATGCCTCGAGTAGTAGTCGTCACCTTGACCGTCGTCTCGGTGCTCTTCCTGGCACTCGCAAGCAGCGGATACTCGT
CCATGGGGTGCCAGATATCGGGCAACCTACTCTTCACCATATACCCAAATGCAGCTACGGGATTGACTTCGCTTGGTTTCGCATCGAATTGGGGTGCTGT
TGTCCTGGCATATTTCTTCATGCAGTTGCACGTCACCATTGCTTTTGCCGTTGTAGTCTCACCAGCATTCTACATCGCGGAGAGGCTTGTGCTCGGCATG
CACCAGCATAACTCTCAACAGCACCTACCCAGAGATGATGTGGAAGCAGCTATCAGCTACGACCCAACCGGAACTCCTATCTTGAAGGGGCAGCATAGCT
CGAAGCGGTCGATGGGGTCTATCGTCTCGATGGCAGATATCGAGAGGaacacggacgacgaggaagcgGAGGCGGCTGAGTACCGCGGCGCCAATTCAAT
CAAGtatgtgctgctgcgcattgCCATTGTTGCATTGCAAGTCCTCGCCTCGGTGTTGCTAAAGGACCACTTCGCGGACTTGAGCGATTTCGTGGGCTCG
TCAGCCATCACTATGAGCTGCATTATTCTACCGATCGTGTTCTActtgaagcgctgctgggAACGAGTGCCCATGTACGAGAAGGTGCCGGCAttgctcg
tcgtcatccttTGCTTTGTGCTGGGCTGCTACGTGACGTATTTGTCCGGCAAGGAGCTCTTTGCGCCTTCAGAAAGCGACGTCAACTTCCCGTTCTGCGC
ACCAGAATACCAAGACCATGTCTACTTCAACTACACAGCCGAACACGAGGCATAACTTCGACGGCAAGCACGTATCTTGTATGAATAGTCGTAGATCAGT
GTAAAGTATAAGTGTAACTTTTGACAAGACCTACTACACATGAGTGAAATTCTTGTCGACTGTGGGTGCAGTTAGGCCTAATTCCAGAGAATTTTCAATG
TGGAAGAGGCCACGGAGAGATCGAGAGCTCATTCCCTTAAACTTGCTGTCGTTTCGCTTTAGCATTGGTCGGGTGGGTTTGGCGGAGCCGTCAGTAGTAG
TGCAAGTGGTTGCTGCGTTCTCGATCGCATGAGTATTTCTTGCAACAAGCAATGCAGGAT