Description :
From Genome Similarity Track
Location :
Scaffold_166:96782- 98134
Transcript NameFunction/comments
Hyaar_Emoy2811699Major Facilitator Superfamily (MFS)
Hyaar_Emoy2811700Major Facilitator Superfamily (MFS)

Sequence
1352 bases(100 bases per row)
ACGCACAAGATCAAGATCGGCAAGCAAGGCGCGATCGTCCTGCTCTGCTGCATTAACCTGCTCAACTACATTGACCGGGGTATCATCCCCGGGGCCCCCG
AGAAGTTCAACCACTTTATTACCGAGACCCTCGGCGTGAGCGTCTTGCACCAGTCCGTGTACTTTGGCTTGCTCACGTCGGCCTTTATTGCCACGTACTC
GGTCTTTTCCATTGTCTTTGGCTACCTGGCCCTTACCCACCGTCCATTCCGCATTATTGCATTGGGCATGACGGTCTGGAGTGGCGCTGTGATCATTTGT
GGTGCAGCACAGGCGACTGAGAGCTACTATGTGCTGATTATTGGACGCCTGATTAGTGGCGTCGGAGAAGCCTCGTTCCAGTGTACAGCCACACCGTTTA
TTAACCGCTATGCACCACCGGCAAAGCGGTCGTTGTACCTCGGCGTGTACTTGGCGTCCATCACGGTCGGCACTGCACTTGGCTACATTTACGGCTCGAT
CTTTGCCAGCTCGGCGCTTGGCTGGGCTGCAGCATACTACGTGGAGGCGGTGGTGATGGCAGGCTTTGTTGTCTGCTGTCTCACGATTATACCGGACGAG
CTGAACCAGATCCCGGTCAAGGAGGTGGAAAGATTTGAGGTGGAAAGCAAGCCGAGTGCAGTGGTGCCTAGTACGCCAGAGGACGAAGACAAGACGGCGT
TGACTGCCTATATGGAAGACAATGAACGCAAGGTGCCTGTTGAGAATACCTCGTTTTGTGTCGAGTCGTGGGCGATCTGTAGCTGCATCCCGTTCATGCT
CGTCACTCTTGGCCAGGCAGCTTACACGTTTTCGCTGGCAGCGATGAGCACTTACAGTCCGGCTATCTTTATTGGCATTGGATTGTTTGAGAGCGAGACG
ATCGTGTCGCTCGTTTTTGGTGGTCTTGTGGCTATTACCGGCACCATTGGCACGCCTGTGGGAGGCCTTCTAGTGGATCATCTTGCAAAAAAGAAGCCCG
AGGAGATTGGTCGTCGCTGCATGATTTCCGTGAAAGCGCTGTTTTACTTTATGCTGGCGTCGATCGTGTTTGGACTTTTGATGGTGGTTTTTATCAGCAC
GAGAATCCTGTGTCTGATTTTCCTCACGCTGTGTCTCTTTTGCATGTGCGTGCTGTCCGTTCCCGCGACGATCGCTGTGCTCGAGCTGTTTCCAAAGTAT
CGACAGTCCATGGCCGTCGCGACGAACACACTGTTGATTCACGCGCTGGGAGATGTGCCGTCTCCTATCATCTTAGGTTATATAAAGGATGAGTGGGCTC
CTCTCTGTGGCACGGTGGAGATTAACGGTAAAGCGCAACTGAACCCGCGCTG