Description :
From Genome Similarity Track
Location :
Scaffold_94:9678- 14759
Transcript NameFunction/comments
Physo_141091hypothetical protein
Physo_121595hypothetical protein

Sequence
5081 bases(100 bases per row)
AGTACAAGTGTAGATACGAAGAAGAAGGGCATGAAGGGCGAGAAGGCTGCTCAACCACCGTTCGATGGCAAGGACTTCGAGGTGTGGTTCGAGCGCATGA
AGGTGAAGCTGGAACGCAAGGGCGTGTGGAAGTACTGTGAGAAGGACATCGAGGAGCCGGAGGAGTCGAAGCAGGACGAGCACGACGCGTGGAAGAAGGA
CTCTGCGCGCGCGAAGGAGCTACTCTACGACGGAATGACGGACAAGATAATGAAAACTGTGAAGTTTGAGCCGACTGCGTTCCGTGTAGTGGAGAGATTG
AAGCAGAGATTCGTCGGAAAAACGTATTTCAAGTATGCAGCTGAAATGACACAGTTGAGGAAGCTCCGACTCCCGGAGAACGGCAACATGTCTGATCAAT
TGGGCGAAATGCGAAGATTTATTGATCGAATTGCTCTATTGTGTAAACCTCTGGATGAGTATGAGAAGCCTGCTATTTTGATCAGCACACTGCCTGACGC
CTATGATAACGTGGTGGAAACATTTTTGCCAAGTCACGTGCCTCGAAATGTAAATGACCCTCCCAACTGTGATCAATTGGAGCATGCGTTGGAACTCGCG
TATGATCGACGCCAAGGACGAAAGCTGGACGAAGGCAGTGAAGACCAAGCTTTGTTTGGAGGATCTGGTAGAGGTCGGGGCCGAGGTCGTGGTCGGGGCC
GTGGCTCTGATCGTGGCCGTGGTGGTCGCAGTGGAGGACGTGGTCGAGGGCGTAGTTTTGGTCGTGGTGGTGGCCGAGGAAGCAGCCCAGGATCTGGACG
TGGTCACGGAGGACAAGGTACCAGTAGAGAGAGATGTTTTCATTGTGGAGAGCAATCGCACCAAGTGCTGGACTGCCCACGCTTAGGCAGACATCCGCCA
AGTGGTGCTCGTGGATCAGAGCCTCCTCAGAAGCAAGCCAAGGTAGAAGGAGCGCAGGGAAAACGAGCTGCTAAGAACCAGTATACTGGAGATGAGAGTG
ATGAATCGGCATACGTGGTTACTGCTCTCATCAAGCAGCCTCCCAACGTGCAGATGTTTGCGAGCAAGTGCTGGTACTTGGACTCGGGAGCCACAAGTCA
TTTGGCTAACCTGAAAATTGATTTTATTTCGTTCACGGCCATGAGTGCATTGGTGCGAGTTGGTGGTGAAATCTGGTTGACTGTAGCTGGAATTGGTACT
GTGAAAAAGGAGATCCAGACTACAAGTGGGCGGCGGACGTTAGTACTGCGTGGAGTACGTTATGTACCAGAGCTGCAATGCAGTTTATTCTCAGTGCGTC
GACAAACCGCACGAACCCTGCCTGCTGATGAGAAGGTTCGAGTTCACTTTGACGACGATGAATTCGCAAAGGTGAAGTTTGAACAAGGAAGTGCGAAGGC
ACATGTTGGCAGAACCAATCTTTATTGCTTGGAGCTGGAGAGTCCTGTGGATTCTGCATTGGTTGTCGCCACTGATGGAGACCACAAGGTGCAGCTGTGG
CACACGCACCTTGGTCACCCAGGACGGACAGTATTCAACGCACTATTTCGCCATGCAGACTGGCCGCTGTTAGCTGTGGATTTGAGAGTCGGGCGAGGCT
TCAACTGTGAAGCATGTGTAATAGGCAAGATGGCGAGAAAGAGTTTTCACTCGGTGCCGAGTTCGACTCGAGACTGGCTAGTTGGAGAACGAGCACACGT
GGATGTTTGGGGACCGTATCCAGTGGTTTCGTACTCGGGCATGCGCTACTTTGCTCTCTTCGTCTACGAGGCTTCTCGCTTCTCGACACTGTTCCTGATG
AAAGAGCGCACCGACGTCTACGCAAAGTTCCAGTTCTACTATGAGCGAGTAAAAACACAATTGAAAATCCGAATGAAGGGGCTTCGTTGTGATAATGCTC
GCGAACTACTGGCGCTCGGTGAGAAGTGCAAACGCAACTACGGAAAGGAGTGCTCGCTGACTGTGAAGCATATCCCAGAGCAAAACGGGGTTGCTGAACG
AATGATTCGCACGGTGACTGAGAGGATGAGGTGCTTGCTGGAGCATTTCGGACTGCCCAAGCAGAAGTGGGCGGAGGCCGCTGTCACTGCAGCGTACTGT
GTGAACATCGTGCCGAACAAGAGAAAAGGAATGCAAGTCCCGTATGCAGTGTGGTTCAGAGAGACACCTGCATATTCGAGACTTCGGACGTTCGGTTGTG
CTGTGTTAGCGTACGTTGACAAAGTTGAGCGTAAGAAAATGGATTCACGAGCAAACGAAGCTGTATTCGTTGGTTATTCTCGTGAGCGGAGAGGCTACCG
GTTGCTGGACAGCAAGACGAACAAGGCGTTCTACAGCCACAGCCGTCTTCTTTGAAGATAAACCTGGTCGAATCCTGTTGAAGGATGGTACAGAGGCGCA
AACAGTCCCCACGTCGGAGTACTTGGACATTGATGCTACGACGATGCAGAATATCCCGGCCTTGCTGGAGCAAGCGCAAGCTGAGGAGAGACATAAGTCA
GAGTGCAGAAAAGGTGGGGCTAGTGAAGGAGCAGTGCAAGCTGAGGCTGCTAGTGAAGGTCATGCACAGCAGATTGATGGTGCCCCAAGTGAGACCGCAC
CGTCGCGAAAAAGAGCGCGTGCGAATGGAATCTCAGCTTCGCGCAAACGAGCCCGCACTGTTGAAAAAGTGAAACCAAGTGCAGAAGCAGCACGGATGAG
TGAGGAGAATGCGCCTCGTCGGAAGAAGAGAAAAAGAGGGAAAAGAAAGAAACGAAGTTGTGAACGGTGTGATACACAAAATGCAGAGTCTGATGGTCCG
GGCATTGGGCAGTGTGTGACACCGGCTGTGGAGCAAGATGATAAGGAGGCAGAAGTGCAGCAGTCTTCGACTCGTTCGCCTGGTGGGATGACGACCGCTA
GCAACGAGAAGCTGGATGCTGATGGTGACTCGCCGATGGGGGACCTAACCGTCTCTGAGCAGCGAGATGACTCTCGCAGTGAGGCACCGAAGACTGGCTG
CAGAGAATACCGGACGAAGAGTGGCAGAGTGTCGAAGCCACCCCGGTGGCTTGATGACACCATTCATCTTGCGTACAGAGACTGAATTAGGAAGAAGCGG
TCAGCTGGTTCATCAAGCTGGGAGGTGAAACGTGATGAAATGCAGTTTGAAATTGCAAAAGAGAAAGCAATGGATTGGTGGCAGGACTTCTGTTGTCTTT
CAAATAGTGTGATTGATGAGCCAGAGACCCTGGATGATGTAATGAATAGCGACTACGCAGAGGAGTGGCGTTCAGCAGCGGATACCGAGTACCATGCCTT
AATGAAAAATGGTACGTGGAAGCTGGTCCCTCACCAGAAAGGTATGAAGGTGCTCGGAAACCGGTGGATATTTCGCGTGAAGTATATACCTAATGGGGAA
ATTGAGCGGTTCAAAGCCCGACTGGTGGTCAAGGGCTTTATGCAGGTTTATGGCGTTGACTACCTTGAAGTATACTCACCTGTGGTCCGCCTAGAGACTC
TGCAGATGCTGCTGACGCTGGCTGCAATCTGCAATCTGGGACTACGAAGTCGACCAGATGGAGGTGACGACCGCGTTCTTGAATGGCCCTATTGATGGTG
AAGTTTACATGGAGCAACCAAATGGGTATGAGGAAGCAGGAAAAGAGGACTGGGTTTGCAAACTGGATAAAAGCCTGGATGGCTTAAAGCAAGCCCCCCG
TGTTTGGTTCCGCCTGCTCAAAGACCACCTAGAGAAGCAAGGCTGCAAAAGTGGTCGACGGTGAGTTGGTATTCATCTCCATCTACGTGGATGATTTGAT
TCTCTTCGCCCCGAACAAGATGCTGATAAAGGAGCTGAAGCAGATGCATCATGTGCGTTTTGAGATGAAGGACCTGGGGCCGATTCACTACATTCTGGGC
TGGGAGATATCGCGCAATAGAAAGGAGCGGACAATTTTCATCAACCAGCTCAAGTATGCAGACAAAGTATTACATCGATTTGGCATGGAAAGATGCAATG
GCTGCAAAGTGCCAAGCACCCCTGCCTTAAAGTTGTCGAAGGTCATGTGTCCGACCCACGAGAGAGGAGAAGGAGTTGATGAGTGGAAAGCCGTACCGGG
CTGTATTTGGCAGTCTAGTGTACTTAATGTTGGGCACACGCCCTGATTTGGCTTACCTCGTCCGTGAGTGCAGTCAATTTCTCGAAAACCCTGGGATTTT
GCACTGGCGCGCAGCAAAGCGTGGGTTGCGTTACTTAAGGGAGACGCAGGACTGGGGGCTACAATTAGGAGGAGTGCAATGGAATGAGCAGGAATTGGAT
GACCATTTAAAAGCTTTTGCAGATGCAGACTTTGCGAACCGAGTGGACGATCGGAAGTCTATTGCTGGGTTCATCCAGTTCTGTGGCAGCACAATTTCAT
GGGCAAGTCAGACAGAACGGACGGTCGCATTCCACACGACAGAAGCTGAGTACATGGCACTCAGTCGTCTTGTCCAAGATGTCATCCACCTGCGGCAGAT
GTTGAAAGAGCTGAAGATGAAGCAGAACAACCCCTCTGATGTATTTGTGGATAACGAGAGTGCTCGATAGCTGGCAAACAACCCTGAATTTCACAGCCGG
ACAAAACACATTGATGTGTGGCATCATTTTGTCCGCGAACGTGTTGAGCTGGACGAGATAACTGTGAAACGAGTGGCTGGGGATGACAATGTGGCTGATG
AATTCACAAAGCCACTGCCTCGTGTGAAGTTTGAGCAGCATCGAGCAAGCATGGGATTGATTTCCCAAGGGGAATACGAGACTACCACGAACTCGTGCAA
CGTTGACAACCAGTAGGTGGGGCTGTTGTGAATTACTGGTCCTCACCTGTTGCTCGTGTTGCAGTGTAGCTTTTGCTCTACAGTAAGTTGAAGTGCAGAT
ACACAAAAGGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGTAAAGAGGGGAAACCACAAAAAACACGAAAAATACAACGAGAGCAGCAAGTTGCTTTACTC
CCCCGCAGCGCGTTCACCTTCTCTTCCTCCTTCATTGTGCGGTGTGAGTTACAGACGCACGCAAAACCGTCAAGTTACAAG