Description :
From Genome Similarity Track
Location :
Scaffold_389:9678- 12451
Transcript NameFunction/comments
Hyaar_Emoy2813986hypothetical protein

Sequence
2773 bases(100 bases per row)
TCTATCTGCACTTGAGTCTTACCTCATAACTGTCTTTGACGGGGGGAAAGTAATCCCTTCCACGGAAGAGGCGGGTAGACTTACCAAGTTTCTTAACACA
CGTCGAAGTCGTGCCACGTGGATCGCAAATTGAGTAGTATTTCATATCTTCCTATCCTTTGACTTCTTCACTCTATCCTTGCCTTGTGCCCTGGCTCTTT
ATGTGACTGGTCAGGAGCAGCCGAATCTTGAAGGGCCTTGGTCTTCCGATGAGAGGTCTTGGTCTTCCGATGAGGGACCACGGTCTATCCTTAAGGGCTG
CGGTCTACGCTTGGGGACCGGATCCACCTTTAGGAGTTTATAGTCATCTTCTTTCGGTACCGCTTCAATATTACTCGGGCAACGGTCTTCTCCTTGATTG
GCTCTGCGGGTCCCTCTTTCCTGAGGGTATAACCATTTTCGTGAATTCTTCTCTCCCATGCGCCCTTTCCCTGAAAGTCCCCCCCCTTGTCCTTTCGTCA
TGAGGGTCTCTGGATCCTTTTTTTGTCGGAAACACTTTACCACAGGATTTGTATTGGCCAAAACCTCCCTACCGGCCATCGGTACCTGCTGAATAGTCTT
TCCCTACTGGCGCTTAGCCTCTCCATTATTCCCACAAGACAAGGCGATAGCCGCAAATTAGTGCACAACCGCAATATAAGTGGATAGCCGCAGCATAAGC
AGATAGACCACAAGCATGTGAACGGCCTCCCAACAAACACATAGTTATTTCCTTTAAACTCCTAATAACCATTAATATGATGCAGCCCCCTCACGAATTC
TGTACACCCTTGCCTTCACATACCCTGCCTTATTCTAGAGCTCGAAACAAAGCAGCTTTTTCTTATGCACGGGATAATGGCTTTGCGATTGCTGTACAAA
GTGCTGGAAATAGGGTTGTCATAGCGGACACTCGTTTCCTGGTCAACGCCCAGCTGCCAGTTGCGGTAAATATTGTGTTGTACTTGTGTGGACTCCTAAG
GTCTAGAAGGTTATTTGTAGTATCAAGCACAGTAAAGAGAAGAACTCGCTTCTAGATTGATGAAGCCACTCACGAGGCCCCTAGGGGGGCGAGTCGCGTC
TGGCCCGCGTTTCAATACAAAATGCATTTGTCTGGTTTCTGTAATTTCCTAAACAAAGGCCGGCTCAATGTTTTAATACTCCATTCATAAGGAAGGTGCG
GATGTGCTGTGCGTAGGAGGTAGGTAAACAATACCCGGTCGTTCAAAGAAAAAGCTCCAAGAAAAAGGTCAACGAAAAGATTGGGTCAATCTTATGTGTT
TGTCCTTCTTCTACAGAAGTAAAAGTGGACCTTAAGGCGTGACGTCAGGTGTCCACTTGCGCCGCGCTCTCGCCTCCTTACGTAGTAACGCTTAACAGGT
GTGAGTAGAATCAGTGCGGTTGGAAGTGGCCGCTCCTTCTCGACCACGTCTTTCGATCTTGCTAGGGCGCTTGGGCTGCGGTCTTCTCATCTACTGCTTA
CTCCTGTTTATATTTGCCGCTACATTTGTGGTTGTGCAAGAGATATTTCTGGCGTCATTGCCACCAGTCTTGTCGCGGCTACAACTCTTTGCTCTCGTAC
TGGTATACTTCGCCCGGCTACAGGTTCAAATATCTATATTAGATCAGTTTTATAGCTTTTCTTTTCATTAAGTAATTTCTATCAAAGCCAAATACCCTTA
CTACAAGTCTCCATCTTACTAACTTTTAGTGTCGGTGGACACATTTTCTATGAGTTAGCAGAGGAAATTAGTAACCTGATTATGCGGCGTCGTACATAGA
GAATTATACATATTAAATTCCATATAATAAAATTGATAATATAAAAAATTAAAGAAATAAAATATTTACCAGATACTATGCAGTAAAGTCAATAATTAAA
GGATTTAAAAGTGAGAACCTCATATAAAACCACTCACTCCTCTTTCACCCCAGAATCATCATCTACCCAAAACCAGCAGAATAATAGCCCACAGACCACT
TACGCAAGCATTCACTTTTGTTTGTAGAATTTGTTCATGTTGTATGTTGTGTTGGGGGGTCCGAGACACTTCGCCATCCTTGTCGTGTGCGGGGGATTAT
TGTTCTTCGTTAGGAACACGACATATTTTTTGACTGACTCTCCATTGATGAGCCAATCAACTATGTTGAAAAAGACGAGAGTGCTCACCCGGCCCCTCAA
TGATCAAGAGATTCTGAATGACGAGTAGAAGGAGAAGGAATGGAACGAAGGGGATAAAGCAGAGGGGGAGGTAATTAAAGACGGATTTATAGGGTCGAAG
GAGATCTCCATATTAGGTAGTGCCTGTAATATGCGTTTTATGTCCCAGAAAACCCATCGTCCTGCATACATACTACTCAGCAGCCCTCAGGCTAATATTC
GCAGTGTCAACGCCACACACACCACCGTTGGTGCTTGGCTTGAATAGGTTAAATCCTACATTTGGTATTAATTCTCCATCTATTCAATTATATCTCGCTT
TATCGATATTAGTTTTAAGTTATAAGTTAGCGATCATAGGATGACCACAGAAAGACCCCGGTGGACATCCAATCCAAAAAATATCGGAGGTTATTAGCTA
TCGGGGGAAGTTATCTTGGGGAGCATTCTATTCCATGTTGCCCACGGATTCTAACACAGTCCTTCTGAGATCTAACACAGTCCCTATTAAAAATGATCAA
TTTATGTAATCATTTGATTGTACATTTTGCTAACAAGGGGGATAGGGAAGTGGAGAGAGAGAGAGAGAGAGAG