Description :
From Genome Similarity Track
Location :
Scaffold_50:96773- 101862
Sequence
5089 bases(100 bases per row)
GACTGTGATCAGTCGTTAATGCCTTCTATATCAATCAAGCTTTTGCCCATGGCCTCAGACCGGTTTCAGTCAAGCATGACGTAGTTTGTAACGAATGCGA
ATATAGCAATCACGTACACCATACCGGACATCGATTTATACCAGTCACATGTCTGCCCAGAGAACCACGTTTTCATGTAGAAATCCTGCTTGACAATGCT
CTTGCCATACTGACGCAAAAACTACGTAGATGTATTCGGGAAATGTCAAGTTCCCCCTCGTTAAGAGAAAAAAGATTTCTTCCGATGGGAGTCCATCTTA
TTGTAAGTATAACAATGCCGCGATAGCAATGAAAATCAATCCACCATCAGAAAAAGTACTGTTAATGTGGGCTACTCTGTACCTGCGAGGCTGTTGATAA
GGCGGAGACAACCATATATGTGTTACCGCTAATCGCGCGAGACGTCATGTACCTATCCCTTCTCGATGACATATTAGCTCTTCTACCTGCAACTTGGGAG
TCTTTCGATCGTTCGGTTGTCTGTGCTGAGTTCTGTAACACTGGAAGTCTGGGTGTGTCAGAACAATAATAGAAATAATTTGCCAAGATGGTCACCGGCG
CGGAACTGCTGCTACATTTTTAACCACGTAAGGATCTGCGGTTGACAAGCGCTGATAGCGACGACCTGCATGTAGAAACATGCACGTGTCAGCGTCACAC
GGATGTTAAATCGTTACCCTCGGGCTCATGCTAAATGTTGATCTGAAACCAAGCAAAGATAAACTAAACAACTGCACTGAGAAGGTCGATCCATACGACT
TGCTTTAGTCTTATTCAATGAATGTAAGAAATAAGCACGAGCTTGATGCATAAGTTTGCAGGCTAAATAAACGGACACTCGACTAATTGCGAAGCAACGT
TATACATTTCTTTTCATCAAATGAAGATTACGAAGCTAGGGGCATGCCCAACGACGCGAAATATAGCTGCTCTAATTAGCGTATTGCTTCTGAAGATGCT
TTGCGTGGATGACACATACCTGGGGCCAAAGACCTTTAAAACCTAATTTATGCAAGCTAAGAATGGTATATGAACTTACCTTACTGGTGCTGGTCAGAAT
CATACACGCCGTGCCTACACCTTAGCTTATGTCAATTTTATATTCCGACGACATACGCGTCAGGTGCTACAGCGCGTTTTGTCAAGACTTGAATTTCTAA
CTAAGCTATGCCCAGTGAAGCGAGCCTTCGTGTGCGGAAAGTGAGATCAGATTCACGATTGTTATGTATTGTTATTTGTCTTATGCAGGTAATGACGGAT
AACTTACTAAGGTGCGGGCAAGTCTGTATCCTTCTGCTGCTCGTCCCAATACTCTTTATACTTTTTAAGAACCAGCTCGTCGGCCTTCGTAAAAGGAGAC
CTGGTTGGACGTGCTTTTTTGAAATCAGCATTGATCACGTCGGGAGCGTATCCCAATTTCGCCCAGGTATGAAACAACTGGACCTCCAGTCCCTTAAATT
CGTGGGCTTATCTGTTTACCTTTGTAAATCAGTACTGAAGCATGGCGGTTTCTAAACACCGACAACAACTCACTGATGACTTCTGATGACGTCTTATAAA
GTCCGTCGACACAGAAAATGATATATCAAATCAAGGTGCCCAAGGTTTTGGTCGCCAAAACATTTATCTCCTGTGACGAGGGCCTCAGCAAGCCAACAGC
GACTTTGACCGCCACTTTATCTGCTGTCCATTCCTTGAATAGAGACGTTTGCATCTCCAGTACCGAGGTCTATTCTTTATGTCGAGATTCGCATACGCAA
CGGAAGAATTGCTTTGCTTCCCCTAGCAACGCAATTCTTCCGTTGTGTGAGCAAACTCGCAGAAGAATTGCTTTGCTTCCCCTAGCAACGTCAGCGTCGT
GCCTTTATTCGTGTTGTATCTCAAGAGGTACGTCTTCAGATACGCAAGGTCCAGAGTCGTACCAGGAAGTTTGAGAGAGCTGTGCATCGACTTGAATGAA
TCGGCTGCACTGAATACCGCCTCGATGACATCTTTAAGATCAAGTTCACCATGTCTCATGCTCTAACTTATGGCCTTTTGTTTCGCTTCCTTATCCATCT
GAAATGCTCGAGCCGCGTCAACATAGTCGCTTTGTCCAGCTTTTGCTACGCTTAGCATAATAGCGTGCTCCTGTACCTTTGTCAGCAATTCTCCGGGATG
CTTGTGTAGAGACGCGAGGTAATTCAAAAGAGCAGCCCGGTCAATGGCTCTTTTCGAGTCCAGGTCACGGCGGGAGAGGCCGCGTAGGTTTGCATCATGT
TTATACGTTGTTTTTAACAGTTCGTTTAATGCACATTTTACTTTGGTCCAAATCGGCGCAGCTGCTCTCTCTTCGCCAGTCGTAAGTCCTTGTGTCTTTA
ACATCTCCTTGGCAGGGACGTCATCATGACTGCCGTCAGGGGGTGAACACTGACCGGGGAGTCAACTGTCGTCATCGTGGGGCTTGATGTTCCCGAAGAG
CTCGCGTTGTGTGTTAGGATTGCGGTGGAAGTCACGAGTGCGATAGCGTAGACACGCACCATCAGTTAATGTCGATGTTGGTCGGAAAGGAATTGAGCAA
AGTTCGATGTGACCGAAGAGCAGCATCTATGGACCTTTCCTGTAAAGGGGTCACGCGTCTGTTGGTATAATCGTTTATTTGTTGTGTTGTGTACATAAGG
ATTGATGTATCCTGTACAAACTATCTCAACGAATTTGTATTGCGTTATCGGTAAAAATCTCCTTAATCAATCAGGGATCCCGAGTCTAACCGTAAAGGTT
GTAATAAGTACGAAGTTATTATGTACTGACGTGTCAGCCGTCTATTAGTTTAAAACTAGTATTTTTAGTAATTAGTATAACCTTTGGAGAAGACTCGACT
AAGGTCTATTATCGTTATTTAATGATAAATGTAGAACAAAAATAAACTATTGCGAGCCCGAATGGTGAAGCTATGAGTGACTGTGCAAAATGAATACCGA
ACTTTTAAAATTAACTTTCTCTTTGTGTGTGTCTGTCGGTGTGTGTCTATGTAAATACCGCTAGGAGTACCTTAAGCGTCGTACTAAGTGCGATTTAGTC
TGTCACCTACTATATGTGAATAACGCTAGATGTACCCTACACGTCGTACGAAGTTCGATTTAGTCTGTACCCTCCTTTCTATGTGTCTGTGGATAACGCT
AGGTGTACCTCACACGTCGTACTAAGTGCGATGTAGCCTGTCCCCTCCTTTGTATATGTCTGCAAATAATCGCTAGGTGTGCCTTACACGTCATACTAAG
TGCGATGCAGCATTTATTCCCATTTCATTACTCAATAGGCATTATTGCGAGCTCGAAGGGTGAAGCTATTAGTGAGTGGGCGCAGGGTTGAATGCCGAAC
TTTTAAATCGTACTTATCTATGTGTGTCTGTGTGTGTGTCTGTAAATAATGCGGCTAGGTGTACCTATTAAGTGCGATCTAGTCTGTCCCCCTTATGGGT
ATATAGGCATATCCGAAGTCACTCTTTGGCTAGGTCACTATTGTAGTGCACGCTTGTGATTGGCTAAGAATCGATCAAAGCTGGATAGGATCACATAAGC
AAAGGCTGGATAAGCAAGCGAAGGCTGATTGCGTTGCCCGAGTATACTGTTAAGGGTTAGTACAGACATAAACAGCATCATATTCATTTTTCAGTAGCTG
CTGTTGTTGTTGTATAGAGTTTTGCAACTTGATTCAGTTGTCCGGACTGAATTACTTATATCATGGGGCAAGCTCCAGAGCTTGCTCCCCTATCTTCTAT
AAAATTGATTTAGGGCGGACAGAGGGCTACCAAGCGAATGCTAGACACAAAGGGGCGGCGGAAGTCTAGCACCTTTTGCAAACAGTATATGTGAAGTGGT
TTTCATCTTAGGTACTTAATATACTGAGACAGTAAGATGATACGGTCACAGTTTTCTCTTGGTAGCAGATGAAGCTTTCTCAATTTAGTTTCTCTTTATC
ATTTGTTTATTAGGTTTTGTAAGCCGCACTTTGTTGTTTACGGCGTTACTGAGTAGGATCATCCGCGTTTCTCTTTTTTCACATTCGTCTGTTTAGAAAA
TCAACAACATCAACGCACAGCTACAATTACACACAATCCACCAACACTCTTATTGATAAACACATCCAAAACCCATTTCCTCGTCGCCAACCCCTAAAAT
GGATACATGAGTATACAGAACTTGATTTAGTTCTATGGACTGAATTCCTTAACTCAAATAGCAAGCTTCAGAGCTTGAACTTCTATCTTAGATTCTCGAA
GTTTACAGTTTTCGTAGTCACGATACATCTGAGTCTTGTAGGCCCCTCCATGCCTTTGTAGTCATCCCCCCATCGATTTTCTCTTAAGTAATTCTGGAAG
CTGCACAAAACCTCTCGAACAACCATTACTTTTTGTCATCTCTTCTTATGTACGGTTAAAAATCATGTACGTATTTTCCTTGCTGACATGTCTCTGATAC
AGTAAATAGGTAATAATGTTAGCTACAGCCTAGACGCAAGGACATAACACATCACCGAGTCGAGCCGGTAAACTGGCCACGACGCTGAGTTTAATCCCTT
CGCGGATCGTCTCTTCCATATCAAATTGTGGCCTTAGCTGGTTATCTTAACTGCTCTCTACCAAAGGCCTACCTGCGCAAAGTCAAAAGCCGCAATTGGG
GTGGATATGGAAGAGGTGATCCGCGAAGGGATTAAACACGACGTCTTAGTCCGTTTGCAGGCTTGACTCGGTAATGCGTTGAGTGGTACATTAAGCTGAT
TTTACATTTAGCTTTTTCTTACCACACGAGTATACTATCTACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN