Description :
From Genome Similarity Track
Location :
Scaffold_112:96772- 99179
Transcript NameFunction/comments
Phyci_107547Hypothetical protein

Sequence
2407 bases(100 bases per row)
CATCATGATAGTGCATCCAACAATGCTCCAATCCGAGATTCAGCAGCGCCATCGTGCGACTGACGCCGACTGCCCCAACGTCCAAGAGCCCCACCTCCAC
CTCCTCCACCATGACCAGGACTGCCGTCTTCCTTGCGGCCTTCTACGTCGATACGCAACCAACGCGTTGATGTACCACTCGCAAAGTCGAATTCCTGAAT
ATGCCGAGTACGAACTCGAAGCAACGGAGCAGGTGTCATCCCACCGCCGCTAGCGTCATTCGAGTCGCCAAAGCGCTCGACATCATCCAGTAAGTGGAAT
GAGAATGCACTAAACACAGTGATAAGGAAGTGACTCGGACGCTCGGGGGACACATCGATCTCAATGGGCCTTCCTCGTGCTTCTGCAGGTCGGATGATAA
GGTTCGGGTTGCCAAGTAATCGATGCACCACGAAATACGAGTCGCCCCCACTGATCGTTCGTGCGCAGGCTTGCAATAAGGCACTTACAGCGCGAACACG
TTCCTCAGGAACTGCCGCAAAGCGCTGAATGTGAGCATCGAGTACCTCGAAAATGTGCTCGAGACCACGGTTTTGCTGCGGCGTCGAAGAATCACCGGCA
TTCTGCTCCGCAGCTTGTTGCTGCTGCTGTTGCTCTCCACCGCCGTACAGCGCATCATTAATGAGAAACAACTCCGGCAGGATGTCACGTAGTGTCTGCT
CGAGTGAGATCGGCTGGGGTCTAGGCAAAAAGATTTGAGCGAAAGTCTCTGCGTGTCGAGAGAAGATCGCCAAGTAGTCTCCCCGTGTACGTGCTCGAGC
TGCTTTCTTGCGGATCGCGATCTGCTCAGGGGGATGGATCTCCCATAGAAGCGGATCGGTCTCGCGCAAATATTGTACACTTCCCAGTTGTTGATACGAT
GCTGTCCAGCGCGCTGTCGTAGTCCGTAGCTCTTCGGTGTCTGCATCTTCCACATCTTGTCGCTCCTTCTCGGCTGATAATGACAGTGACGAAGACGCGA
GGGCTGCCTTGGTTGCCGTAGGAGACCGGAATCGGTAGAACGGTGTTTTGCGTTTTTTGTCGGGGGTTGAAAAGGGTCCGAAAGACGAAGAGGAATGAGC
TGGTAACGTCGACGAAGACCCAGCTGTGGCAGATGCTAGCTTGCAGTAAAAGGATGCACGATTGAGAGCTGCAACCCAAGCGCTCACAGCGGCCTCGGTT
TCTTCAACAACGCGCAGTTCGATTGATTTTCGCCTAAAAACAACAACACAGTCAGCTGTAGAGTTAGTCGACGCTCAAGAACAGGACAATGTTGAGTCAC
GTACGGGAACACTTGATGCGTGAGCCTTGCTGAAAATTTGAGTACTTGCAGTCGACGGTGTGAGCTCGCACTAGAAATGCTGAAGGCCATCGCGTGGTCA
CCGCGGCCACGTTGAACAAGTGCATGATCCAGGAGTACAGCACCACGCGGAAGACCATCGGCCTCACTAGCAAAATAATACAAGCGGTTTCCCTTGAGCT
CAAAGTAGCGTGGTTGCCATGCACTACCGAGGCCGTGCTGTTTGCGTTTCTTCTTCTTAAGCCAGCCCGTCTTCTCCGGGGCGAGGTGGGCTACTGGATC
CGTTATGCTATCGTCATCGGTGATAGTAAATTCTCCTTGTAGTGACGCGTGCTCCGATGATCCAGAAGGTTGTGATGACAACGAAAGCATGGACCACGAC
AACGGTAGAGCTGAAACCTGTTCGCTGCTGTCTTCTTCCTCATCTTCGTCATTTTGACCGCGATCAGTTGATTCGTCTTCTTCCCTGTGCCTTTCTGCAT
TCGCACCGGTCGCATTTGCATCGTCATTTTTCTTCTTGCCAGTCCGTTGAGCTTGTGAATGCCGTAAAACCTCAATATCCTCGGCCACAAGCGTGCTAAA
GGGGCTTAATTGAAGTTGTTCCTGGCTCAGGTCTTCATCGTCACTTCTAGTAAGTTGAATTGGGGATGATGGTGGCTGCAGTGACTGAGGGTCACTGCCT
TCCTCACTCTCAGTATTAGCGTTAAGTGCAGCCGGGGTAGATGGCTGCTCTGTCGGTGAGTGAAGGGATGGTGTACTTGTTTGCTTGGAAATTTCAGCCA
CAGCTTGGTTGATTCTGTGTGCCAGCGTAATATGTTCCGCGTGGAGCTCGCCTGAGCGCGTGAGCGGCAGTGACACTGTCACAGCCCAAAGTTGTCGCCC
AATCCATTGCAACGACACATCCGGGTTGATGGCGTTGGTACTGGCAGCCAGTGGAGACTGGCCACTGGTGCTCGAGGTGTCCGAAGCCCATTCTGAGACC
ACTCGCGCTACCGTCGAGACAATAGCAGCTCCCGCCTCCATAGTCCAGCACGTAATGCAAGCCTTGAAGAAGTCATCCTCACGGTACCAGCGTTCAACTC
GAGCCTG