Description :
From Genome Similarity Track
Location :
Scaffold_29:96771- 103275
Transcript NameFunction/comments
Albla_Nc14031950conserved hypothetical protein

Sequence
6504 bases(100 bases per row)
ATAGAATACACTAGTTGTTGAAAGCTGAGCGAACACGGCGTGACTGCTTGAACATGATTGGCAATTTATTTTTTGATTCTCCTTCAAGTTCAAAGTGTGA
CTAGAAATCTAGAGCCTATTCTCAAGTCTTTTCAACACTTTTTCTTTTTTGTTGCACTTGAGCTTGTGCCATCTTCAGCTACATCGTCCTATCCCTCGTC
TGCCATAACTATTTGAGCCGGGGAAGCCTCGGTGGTAAAAACTACTTTGTGTGCAAGTCGGCCAACATATACCCACGTACCTTAGTGCGATAATTTTTTT
GACCCAGCAGTTCTTGGCCGTATTTCGGACCTCTTAGCTTTTGGCCACAATTCGGTCAATAGTCATCCACTGGCAAAAAGAAAAATACCTATCTGATTAG
CACGTTCCTCTCTAATCATCTTATGACAAATATACCTTAAAGACGCTTGATTGTCATCGTTCCATGTGCAAAGTAGCTGATCTGGAAGTTGATGCATCAG
CATTTGTCCACTCTACTATTTGAAGCAATCAAGAGTTCTAATTAGAGTGCTTAATGTACAAAGGGCAAAAGACACAATAGTGCGTAACTTGTACTTCTTC
CGTATTTTTAAGTTTGGTGCACACAAAGACCATGCATGTATTTTAATGTTGTGTGCACTGTACTAAATGTATATGAATTGAAGAAGTATATTCATTTGCA
AAGGTACTAAAGTCTACTCGTATGTGTGCGCTGAAGTAGAGCGTATAATAAGCTGGGGAGTATGAATTTGTGAAGGTAAAATGAATCACCCACCTTGGTC
TTGCAATAGAGTGAGAAACATCGTTTTACCCAGAAAGCACTTGCTTTTCGGGACCGTAAAGGAGGTGTTTCGCCAGGTATCAGATAGAACTCTCTGTTGT
CCACGTCCGCATTAAACCATTTCTCGTTCACAAGGATGACCTGCATCATACTGTCGAACTTAAGCTCTTCTTCACGCTGCTGAACACACTCGAGCGCAAA
ACGCAACCTCTGCGTCAAAGTTGGAGGTGCCAAAAGCGGTTTAATATCATTGCTGAGTCTGTTGAAGCTTCCTCTCGAAAGATGCGATGGATAACAGCGT
CGACACCAACACCAGGGCCGAGAGAGCGAATCCGCATGCGCTTCTGGCGAGAGATGAGCTCCACCATATCGGTGTCGTTGAGTCGCTTGCGCCAAGAGAT
CTGTTGAAATCTGTTTGACACGCTCCCGACGGAGTCGTGTGCGTTAGTGCTATCTTGTCTGTGTGACCATATGCGGCTAATTATGCTGCGATAGCGGTGG
AATTGTTTCGCTGCAGCACTGGTATTACCAGAAATCAGCACGCCATTGTTGCTTCTGGGAAGCAAAAAATGCACAGCCTGCGCACGATCCGCGTTGGACA
TTTTCTTTGAGAATGTAGGAGAACTGACTGGGATGGTGTTGGTGCACATAGTAATGCGCAGCGGGTGGACGTTAGGATTGTGAGGATATGGCGATGATGT
AAAAATGCATTTGAGCAGTCAATTTTGCGCGCCCGTGACCAGCCAATATATAGAACGATAGTGCTGATTGTACTGGACAATAGTATTTAATTATATTCCT
GTTTTGATCAGTATTACTTCTTACTAGCCTTAATTTGCCCTAGTGCACCAATAATTCAAATACGGAGGAAGTAATAACAAAAGAGGGTATTTATAGTAAT
CCAGCAAACTAGGATGCGGGGTACTGCTTGGTTTGGGATTTCGGTGTCAGCATACCCCTCGGTATCAGCAACCAAGATACAACTCGTTGCGCAGGTCTTC
CTGGGTCAAGAGACGCCACTTGACATCGGCTGTCTTTCAGCGGCCTTGCTTGTCTGGAGCAGGAAGCAGAATTAAAATCTCACTCCGAATAACTTGATGT
GTGAGGAGCCAGGATGGCGAGGTTTGCTGTATCCTGGAACCGTTTTCTTTGCAGTTTTTAAGACTTCTTAACATCAAGGGAAGAGAAAGCGTCCAAATAC
CGGCCTCCTCGAAGCCAGCTGCGAAATTTTCTGCTTTCTCTTCGATTCCAATGCTCTACGTAGTCGACGCTGACTGAACAGCTTCTTTCTTGGCCATGGC
GGTCTTACTTGCTGCAAGCATGAAGCTATACATCTTCTCTTTCAGAATAGTTTACACCGCGCGGAATACTGCGACGTTCAGTGGCTGATAAAGGTGGCTG
GAGTTTGTTGGGAGCTGCACTAGGCGTACAACACACGTGACCGCCGCTGCATCAATCGATGCATCCAAGTGGCTGGATACTCCGTCAAACACACGGATCA
GAGGCCACTTGAACGGTAACGAGACCGCGAGTGCAAACGTTGCAATATATTCTCTTATGATAAGCTGGTCATGAATCCAGCTTCGGAGGTCGTAATTGTG
GTGTTGGAGATGCTGCACGCATCGATAACGTCCCGGTTTAGTCACTTCCTGGTACGATGAATGACATTGGCACAACGAAGCCATCAGCAGACACGCACGC
CACCAAGGTGAGTTGAATACCAGGTTCAACAATCTGAGACCAGACGTTCTTTGAGTCCCGATTCGGAATGACCTTCCTTGTCTTGATTTTTTGCATTATT
CTCGTTTCGTCCAAGTTGAAGATGTGACTTGGATCGGCGTTCTCCTCGATAATTGCGCGCACACAACTTCCAAAAACCTTACCACAGCGTCATACACAAC
GCCTCTACAAACCCTTTTGATGATGTGCGCGTTTCTGATGGCAAGCTCGGGGAACTTCTTCAAAAGTTGGTCGCACCAACCGCTACTGATCGTCCCAGCA
TCGCGCGTCAGTCCGTAGAAATCAGCGTACATATGTTACCCTTGTATCGTGCGTTGGAGGAAATCTTTTGCGCTGCATTCCGATCAACTAATCACGAAGG
TCTTTTTCGAGCGCGTTGCCGAGGACCGAAGAAAGACCGCTCCTTTTCTTCTGCTTTCCCTTCTTCTCCATGTTGATTCGCTCGCGGAGGGAGTGATCAG
GAATCTTGTACTAGGCCATCACGTCCCCTATCTTCGCACCGGATTTGCGTTCGGCGATGACAGAAAGAACATCTTGCTCGCTATTAGTCTTAGTCGGTAT
CTAGTACAATGAATTTGTAAGGTTCCAGTCACACACTTCCGTGTGATTTTGTTTTGGGCGAGAACTGAGCTGGTTTACTTTGCGCACTTGACATCGGCCA
CGAACTGCTGTAAAAACTGGCTGTTCAATCAAACCAATACTGTATATAATGTCAATTTCGGTTTTTGATTGGCGGTTGTTTTTTCCCGGCCAAAAAGTGC
AGTCGTACCTTAATCTTTCTACCTTTCAGACCGTGTTTATAGTCTGCGTTTTCTGTGCTATGTAAGTTAGCACTCGAATGATAATTTCTCTCCGGTAGAT
TCTCGACGAATGTATAGTAGAAGCTAGAAGAGTGGAATATACATAGCTCCAACAATAAAAAAAGCTGTCGTATACTTCATCAAAAGTCACCCATTTTGAT
ACCGTTCCTGGAGGACAAATGACGAAAACGATAGGCAACATTGATTGCTTTCTTGAATTTATTACACGTTTTTTGCCTCCTTTTTCAAAGTTCTACGTGT
TCAATTTTTTTTCGCGACAAGGACGAAGAAGAAAGTGGAACCTATTTGGAAAGCCTTTATCCGCGCAAATGGTAAGCGTCGTCAACAACGTAGCCACAGC
GACCAGAAAATCCTGCTATGCTGCTCTGGATCATAGCTTTGAGGGTCAACTCGATCCAATGCACATCATTGAGTATTCTCTAGCATAGGCAAGCATTCGC
TGGTAATCGCTCGCCAGGTGTGTTTTGCACGTAGAAATCCTACAGCTTGAATGCAGCCAAGTCATTGACCAAAGTCTCACATCATGTAGAAATCAAACCC
TTGCGCGAGGCCGCGTTGTACTCGTATAAATGCCACACATCTGAACGAGCAGTGACACTGGAGTCAATAGATACACAGACACTCCAGGCATTTGTTTATC
CACTAGCTGTAAACGCCGTCTTCACATATTTAAAAAAGTTTCTTTGCAAAAAAACGTCTAATTACAATTGGAATATTCGATGCTAACTCGGAAATACAAA
GCATTGCAAATGAAAGTATCGGTTTTAATAGCGGGCATCTGAGAAAAGCTCGATTCAAGCCATATTATCTCTTGAGAGATGTCGGGTCCGACGATTTCCT
ATAAGCACGCACTCCCTTCCAACCCTATCGCTGTGGTAACGTGATGTGCAAAGCATATCAATCACATATACAAGATCAAAGATAGTATGGATAGGCCCTG
TCTCGTAAATCTCCATTAGCTGATCGAATAAAAGCCACGGTCAACCTCTTTGAGGTCCTTTAGCAAGTCCATTGTCGGTAAGGTCTCTTTCAAGTAGTGA
TTTCGTCTCGACACATTTCGATTAGTTCGATGATGTTGTGCACATTCGGTTGCCCTCGCCATCTGATTCAAGTATGGAAGGTAGTCCAAGATGACTGAGT
GCTGATTCAAGTTTGGTCTACAGTAGTGAATATCACTCGCTGTCCATTTCATTTGCGTGCAAACCACGTACACTGCCTGAGACGTTTGGAAGCATTTTCT
CAGCTTTTGTAAGGTGCCCTCTATTCCAATGCTCCTGACTCACAATTGCAATTACAAGAGGCCTAAAAAGCGCAACTCAATATCATTGACCTGTAAGTTG
TTGCAGTGTTTTCATATTCGAATGCCACAGAATACGATGAAGAACACATAGATGACAGTCGTCGCAGTGCTTTCAGATCCATATCCAGTGATATCTTCTC
AAGTGTACCTTTTTCTGACGGACAATGGACCTGTTCAGTGATTCAGACGTGAGCCCCGGCATTTCGAAAAGATTTCATACCTCATCCCAGTGTTTCATTA
GACTAACATCATCGATCCATTTGGTCAAAGTATATAACATCTCAATATCATTGATTTTGATCTGCTTTTCGGCGAAATGTTGGATTAAATCATTCTCTTT
CTCTGTTACTTTTCTAAGACATACAAAGGAATACGGGCGCAGAGTCTCTCCCCAAGTAAAAGACGGAGTAAGAAGAAATTGCGTGCGATCGGTGCAATGC
GATTGCCACACTGTCGACGTGATTTCATCCATTTCGAGGTGACTCTGACGGCGACGTTTTTGATAAAGGATTGGAAGATACGTTTGTATGTAATGTACCG
ACGCTCGAATATTGCATCGAAATGCGGTTGTCACCATCTGAATGAGTTGGTAAGATAATGGGATTTGCTCTAAAAATGCGATCATCGCTAGATATAGACA
GCATTCGCTGTGCACTAACGCTTTCATCGGAACTTGTACGTATTTCCTGAGTTCCAACGGAGTTTTTGTGCATGTTGCTACAACGGGGCACTTTGACTGG
ACTGCGACCTCACAAATTGCTGAAAGGAAGCCTTTATCTTGGTCGCAGTGAATGTCTACCTGAATGGAGGGTTAGCTACAATGAAGGAGAGCGAGTCTGT
GCTCGTGCTTACATCGTCAAAGAGAAGTAGTGTTGAATCTTTTCGTTTGGAGAGCTCCGACATAATGCATTTCGATTGCGTTGCTTCTCCAATGATATCC
AGAACTAGTTTTCTCGAACGGTATTGACCAGAGTTGACTTCGATAACATTGATATCCAACGCATTTGCACTCGAGTGAACAAGCGCGGACTTACCCACAC
CAGAAGCCCCACTTAATACAAGAATATCTGAGCATTGTTTGCTCATAGATTTCAATGCACTATATTCCGACTCAGATTCGGAGGACAGGTCAATCGTTCG
ACGAGTTTGTAGCCATAACCGGAATGCGGCATTACCGCTTTCATTTCCAACCAGCCCAGACGATTGTATCGGAAAGTACTTGTCTAATAACGTCAAATTA
CACTTTGATGGGCCTGTTTCTCTTGACAGTGCTAGTACCTCAAGTATCGTTCTAACCCTGGATGGTTCCCAAAGAGAGAGTTTCGCAAGACGAGAAACCA
TCTGATCAATTGTACACTCATTAATTTCAGCATCTAGAAAGCTGCACCATAGCTGGGTCACACGCTCGTTAAAGTTCTGCATCAAGCGCGATTCCTCTGA
CTGCTTTGAATTCGCAAGCCACGCAATGGAATCCCAACTGACAGACTCATTCAAATCGGAGACGTCCATAGTTGAATACGAACATGGAGCACTCGAATAT
ACACCAGGATGCTTTGATGCAAACACATGCTGAATGGGCGGAAATTGCACACAGTTTTGTTCCACAGATTGTCGAAGTTGTGACTTTTTTGTATATGAAG
TGATATGTTTCCTGGGAATCTCTGCGAGAGTCTCATTTGTAATTGCCTTTTCATACGGGAAATCCAGACACTGCGATCGCTTTGAAGTTGATTCTTCATC
ATTGCCATCTGTGGTGGAAAAAAGCGGTCGTTGTGTCCATCGAACAGAATCTTTGACCATATTTATAGAACGCTTTCGTCCTCTTCTTTTACGTGTTCTA
ACTG