Description :
From Genome Similarity Track
Location :
Scaffold_782:9677- 12211
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_782-snap-gene-0.5Ectodermin
Pytar_ATCC12531maker-par_contig_782-snap-gene-0.6Novel protein
Pytar_ATCC12531maker-par_contig_782-snap-gene-0.9Conserved gene of unknown function

Sequence
2534 bases(100 bases per row)
CAGTGTGCTGAGTGCCGCAAGCCGTCGTATTTCGGAGCGTTTGGTGCGGCCGTCGCGAAGAAGACGACGGTGCCGGCCAAGTGCCTGCAGATTATCCAGT
GTCTCAAGTCGCATCCGTTCGCGAAGCCATTCTTACAGCCCGTGGAAGATGTCCCGCACTACACCAACATTGTCAAGCAGCCCATGGATCTCTCAACCAT
TGAAAACAAGCTCTTGGAGAACAAGTACATGGTCAACGGCAAGGGCTCGATGCAAGCCGCAAACAGTGGTGGTAAGATTCTGCATTTGGGATTGTTTGCC
GACGACGTGCGGCTCGTGTGGGCCAACTGCAAGCTGTTTAACGACGATGGGTCGGGAATTACACGCGCGGCCGACCAGCTCTCCGACGGATTTGAAAAGC
TTTATCAGGATGTGCTTGAGTTTGTGGAGCAATCGGCGACGACGAAACCCGCTGCCAGTTCTGTGACGCGAGAAGAAAAGAGACCGTCGACGCATGCAGC
GACAGTGCCGTCGTCAAAAGCCCGAGATCCCGTGTCAAATGTGTCGAGTGCACAAATTAATGTAGTGAAAGCGTCAGAGCCCAAGTCGAGTCTGCCGCCA
TCGAGTGCTCCACCACCATCAGTGAAGCCCACGAGTGAGTCAACCAGCCTACCCTCCAGAGATCCTGTCATAAAAGACTCGGCAATCGGATCGGGTTCAT
CCAAATCGACTCCGGCAAGTGTGGCGGGCAAAGCCGATTCACCAAGCGGTGCTTTGGAGACGTTGGCGTCCACCGCAGGGGCTGTTGCTTCGAAGGAAAA
GGATGCCACTACCGTGTCTCCTGTTGAGGCGTCCGATCCATCCACCAGCACTAGTGAAGACAAGAGCAAGCCGGTGGAAGCGTCTGCAGCCCCACCCACC
TCTCCGCCCACCTCTCCGCCTCCTGCTCCGGCTGCCCTGTCGACGCCATCGCCGACCGAATCGGCGACCACGACGTTTACAAAGCCACCGACAAAGCCAC
CGACAAAGCCACCGACAACGTCGAGTGCGGAGTCTACAGAGAAGCAGGCAGTCGACACGCGTGTGGTCACAAAGGAGAACGAGACTAATGGGGCCAAGCT
TAGAACCGACGCACCCACTGCGCCACCGAGTGTGGGCGGTGCAAGCACCATGCCTGAGGAGCCAGCCAAGTAAGTAGTGCGAAGCGAAGAAGAGAGCAGG
ACGGAGCAGAGTGCGTGTGTTCACGTTGGAACAATATCATGAGCGTTCTTGATACCATGATGTTCGGATCCCGTGCGTGTGGGATTATGGAAACGCTCCG
CCGTATTGGGGCGGTGGAGTTCTATTTCGAGTGCTGGTGGGTCCAGCGGGCGTTGAGCTGCGACTCTTTGGAACTGCTTTCTCTTCCTCACATAGGACGC
CCCATGGACCTGACGCTGGACGAAGAAGGCGCGCAGGTCACGGCCGCGACGTCGTTTGACGCCAACTTTCCGCCCAAAAACATCCTCGATGGGTGAGGCA
ACGACGCGCTCGGAATGGGAGACGAGTGGGTGGCTAACTCCTTCATGCTTCCCCACGCAGAGACAACTCGACCAAGTGGATCACGTCCGGCAGCTTCCCG
CAGGAGGTGATTGTGCAGCTGGCAACGACAGCGTCCATCTCGCGGGTCAAGACGTGGAGCTGCAACGTCAAAGAAGTGCTCGTCGAGGTCTGCACCGGGA
CGACGCCCACCAAGTGGGAGAAGCTCTACGAAACGAGTAGGACCAAGGTCTCTTCTGGCCTCCCCATATACTGTGCGTTTGACTGTGTGGATCGTGGTGG
CAGAAATCCCTGAGAGCGACGGCAATCTACAGGTCGAAAGCGAGAGCGTGCGTCCTGGGGACGCGTCGTTCATCAAGTTCAAGATCCTCTCGGGCTGGAA
CGACTTTGTGGCGCTCCATCGCGTTAGTGTCGAGGGCTCGACAGCGCGGCGATGAAAGAGATCCAATACATCCCTACCGAGTCCCCATCAAGAGGTATAT
ACACAACTAGTACCTATCGAGTCTACTTCTTTCCAAAAAAGGACGAAATGGACTTCATGCCCGTGCGGTCGACATTGGCGAGCTTGCTCTTCTTCTTGGT
CGCCGAGTTGGTGGCGGCGGACCCTCGCTTGGACGGCGTGGTCGTCGCTGGTTCAGGCTCTGCTCGGCGGTCGAAGCGGCGGATCGTGNNNNNNNNNNNN
NNNNNNNNNNNTAGCGGAGCCGCAGCGGACGACGCAGCGGACACGGCAGTATCAATAGTGATGCTGTGAAAGAAAGAAACAATCGTTAGATGCCCAGTCC
TTGACGACAAAAAGAGGTATGGAACGTACTTGAAGTGCTTGCGTAACGCTGGCACGATCGAGATAGGGAGATAATCTGCTAGCACGTCGACGGCCTCGCC
GTAGAACCGCTGGATCTGCTCAGCCGTTGGCTCCGTGTCGGCCGCCGCCCCCGCCGTGTCGTCTTGCGTGCTAGAAGCCTGACCCGGTAGTGCAAACTTG
GCATCGAACGCGCCACTGGCAGCGTTGGACGCNN