Description :
From Genome Similarity Track
Location :
Scaffold_135:9673- 13980
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_135-fgenesh-gene-0.1CG5013
Pytiw_DAOMBR242034maker-piw_contig_135-fgenesh-gene-0.2Suaprga1
Pytiw_DAOMBR242034maker-piw_contig_135-snap-gene-0.16Glutamine-rich cytoplasmic protein (Eurofung)

Sequence
4307 bases(100 bases per row)
ACTATGTGGTGCCGCAGGTGTTCCTGACCGACCGGTCTGACGCCATCGACATCCAGCGCAACGTCGAAGCCAACATCGCACTCAATGGCATCGAGGGCGT
CGCGCGCTTCCTGGCGCTCGACTGGGGCCACGTGGCAGTGAGTGACTCGCTCCTCCGCATCTTCGAGACAGTGGACGTGCTCTTGGCCGCCGACTGCTTC
TATGCGTCTGAAGGTACGAGTTATCAAAGCCAGAGCTCGCTCATTGTCAGTCTTGTGCTCATGATGCTGTTTATTAACAGATTTCGAAAAGGTGATCGCG
AGTGTGGCGCTCATTTTCCGCTGCAACCCAAAGTGCCAGCTCTACGTCACGTACCAGCTTCGAAGGTGCGAGTCAACGTAATACAGCAATTGATACTGGG
TCACTGGACTGACGTGTGTTTCTTGCTTCAATGTGGCCAGCATCACGCGGTCGATCGCGCCGTTGCTCGCGCGTTGGCGGATGCAGGCCAAGGCGCTGGA
AACGAATGCTGACATAGCAGACGCTGGTAGTTATGCTGACAGCCTGAGTGGTTCTGACGGAGAGAGCGGCGACTACGAGGCGCGCCGCCACCACGGCTCG
GAAAGCGTCTTCCTGTACGAGATCTCGCCTCTCCAATAGACACAAACACACATGCGCAAGCATCACATACACACACAAACACGCATGCAACAGTCTCTGG
ATGGCTCAGCTTCGCCTTTTAATCTTCTTCTCTCACATTGGCGGCCAATCGCCTGTTTGTCAATGGCAAACCCCATACACAATGTGCCTCTCCAGCCATC
TAGAAGCTGGACTGTGGCTCGCGCCCAGCCTCTTGCCTTTCGGGGGAGAGCAAGCAGGTGCTGTGATATAATCCAGAGCGAGCGACGCGTCGCAGAGCGA
AAGACGATGGCGCTTCAGCGTCTGCTCTGGTGCGCATTGCTGCTTTGCGCCGCTCCTGTCGGATACGTGTTTCCCAATCGAGAAGCTAAATTGTAATCAT
GAGTTGTCGTCCTCGCCATCCAGCGGCTGCTGTCTACTAGTGCAGTTGTAGTACAAGCAAATAGAGTACATGTAGCTCACACACACACACGCATACCGAG
TTGCAAGCACCCATAGGCGGGCGTCGTCAGGCACGCGCCTTGGAGGTCGGGTATCCTTTGGCAAATGAGACCTCAAATGAGCAAAGAGGCATTTATGAGC
AATGACCTCTATTTGAAAGGTAACAGTACTTTCGTGGGGATCACTGCTACAAGGCAAGGACCTCTATTTAAAAGTTAATGGTACACCGCCACAGGGCCTC
TATTTGAAAGATACCGGTGCACCCTCGTGTGCGCGATCCAGTTATTCCGCGAGACGCACACTCCACCGCAGAACGCCAGCCAGACAATTCACCACGATGC
TCGCCCGTGCCGCCCGCGCCGCCTCCGTCACCATCGCCAAGCGAGCCTCGGGCTCCAGCGCACTCGCCTTCGCCGCACGCAAGGCCGCTGCGCCAGCGCT
CTGCGCGTCCTTCCAGGCGCGCGAGAAGTCGACGCTCACGGCGCTGCTCAAGGTGAGCTGCTCGCATTTTTATGTGAAGAGCTCTTGGCGCCCGCCATGC
GCTGCTGTCTATTAGAGCTGCGTATATACTGACAATGGAGATGATGTGCGTATACAGCGCGAGATTGAAGAGGAGAAGGGCAACTGCTTTGAGGGCGAGG
AGCTCGAGGAGCTGCACGCCAAGATGAACAAGATTTTCACGCTCAACGAGAAAACGGGCAGCATGGAGATCGAGCTCACGGGCCAGATCGGCGACGACTC
GATCCGCGTCAAGTTCGACTCGCAGGACGTCGTGGAGCTCGACGAGGACTTTGAGGGCGACGAGGACTTTGACGAGGAGGAAGGCGAGAACTTTGACGAG
GCCGAGGAGAGCGACGACGAGGACGACGACGAGGAGGACGAGCTCCCGGGCATCCGCTTCGTCGCGGATATCACGCGCGCCAACCAGGGCCTCCAGTTCG
AGTGCGTCGCCAGCAGCAACCTCACGGTCGAGCGCGTGCGCTTCCTGAACGACTTTGCCGCCGACGCCGAGAAGGACAGCCTGTACTTTGGCCCGAACTT
CGCCGACCTCGAGCTCGACGTGCAGGAGAAGCTGTACGACTACCTCGCCGAGCGCAAGATCGACGACGAGCTCGCGCAGTTCATCACCCAGTACGCCGAC
CTGAAGGAGCAGCGCGAGTACCTGTCGTTCTTGGAGAGCGCCGAGAAGTTTGTCAAGAACTAAATAGACACGACCCACGTGCGCACAGTCAGCAAGCAGC
GCAGAACAAACACACACGTAAATATCACCAACACCACACGTCCATACCCAACGAATGCAGATCGATTGGTTCATATGTGTAGCTTCTCGCTCCTATCTAC
GGGGTCTGGTGAAAAGGAGAGAAACAAAATGAGATAACCAGCCATGGGAAGCGTCCCTTATCCTCTCCATCACCTCACGCTCGCTTACTGCATTCTGGAC
ATGACGCTCTGAAGCATCTGCGAGACCTTTGGGTTGGACATGTGGCGCATCGCCGCCGACGGGCCCTGCGTGTCCACGTCGTGGAAGAACTCCTGCAGGT
CTGGGTCGTTGCGCGCCGCGAGCAGCTCGGGGCTGTTCATGACTCCGCTCATGTCTGGCATGCCGCTAGGAGCCGAAGGTGGAGCGCCAGCACCAGCATC
AGCACCAGCACCAGCACCGCCCATACCGTTCATCATGTTGCTCATCATGTCTGGGTTCTGCATCATGTTTTGCGCCCTGTAAAGTAACCACAGAAGAATT
CGTTAGCTACCAACAACCTCACATTGGCTCCAAGGAGAGCTCATACACACAACGTACATCTGCATCATCGCTGGGTTTTGCATCATACTCGCGGCCATCT
GCTGCATCGCTGGGTTGCTCATCAAGTCTGCGAGACCACCACCGCCGCCGCCGCCAAACATGCTGGCAAGGCCGCTCAGGTCTGGCATGCCACCAGCACC
AGGAGCACCGGCACCAGCTCCACTCGATGGAGCACCAGAGGTCTGCAGCTGGCGGCGCTTGCGCTCGGCTTCCGCGAGCCCGTCCTTGCACGCGGCGTTC
GAGCTGTCGACCTCGAGGCCGCGACGGAACGCGTCCACGGCACCGTCAAAGTCCTTGAGCTGCACGTAAGCGTGGCCCATGCGCGAGTACGCCTTCACGT
ACGCCGGCTTTAGCGCGATCGACTGCTCCGAGTGCGTGATCACGTCGTCGTACTTGCCCAGGTACGTGAGCGCAGCCGCGAGGTTCGAGTGGTAGATGTG
CGAGTTCGGACCGTCCACCGACAGCTTGAGCGCCTCTTCGTAGTGCGTCGCCGCCTGCTTGTAGTTGCCAGCAGTGAGCGCCGTGTTGCCCTTGCCCTTG
GCCTCCTCGGCCTTGGCTTCCCTCTCGGCCTTCGAGAGCGTAGGCTGTGTGGGAAAGAGTGACAGTGTTAGAATCATTAGGACAGACAACTTGATACACC
AGAGCTTAAACGCAAAAGCAAACTTACCACAGTCGCTGGCTTCTTCACGTCGCCAAACTTTTCTTTGAACTTGGCGAGCGCCTTCTTCGTGCGGTTCGTG
TGCTCCTCCGAACCCACAGGCGCGTTGTTGAAAAAGTTCTTCTCGTCGAGTTTCGCAACCCACTTCTTCCACAGGTCTGGGTCTGCAGATGGGGCATCAG
CAGTACAAGTATATAACAAATTCAGTCGTTAGCATTTCTTTCATCCACGATAAGAGAACATATGCAAATAACAGCACGTACTCTTGGCGACGACAGGATC
TTCATCGATATAGTCCAGTGGGGACGACTACACATTCACAATAACAACAAGAGTAACAGCAGCAGCGGCATATTAATATCGCAGTCACACACGCATACGA
TTGCCAATAGAACGCCATGGATACAACTAACTACGCACCGCGACGCCGACTTCGACGTTAAGCGCCTTGAGCCCCGCGACGAAGACGTCTTCGAACGTGG
CCGAGCCGCTTAGCGCGTACATTCGCTTGAGCTGCTCGTCATGCACATCCAGTCCAAACGCCTCACTGCAGCAGTAGTTACAGGATACAAGAACCAGTCC
ATTAGCACACGTGTCGTTATGACCACCATCGGACCGCATTCGTGGACCTCTCCCCCTCCACAAGCGCACAAACACACAAAAAAGCACGCACCTGAGGCAC
TGAACGCCCACCTCGACGTTCTCCGCGTCCATGTGCGCGTCCTTCTTCTTGGCATCGATCCACGCGAGCGCGTTGAACAGCGCGGCTTTCGTGGCGCTCT
CCATCTT