Description :
From Genome Similarity Track
Location :
Scaffold_811:967- 9704
Transcript NameFunction/comments
Phyag_g8161hypothetical protein PHYSODRAFT_323413
Phyag_g8162hypothetical protein PHYSODRAFT_477622
Phyag_g8163cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
8737 bases(100 bases per row)
CATGCCCACAGAACCTCGTCGTATTTCAAGGAAGGTTGTGATGTTGCAGCACAGATCAGCTAGATCGGCACCCTTGGATACAAGTTCAGCCTCCGAAACT
CTGACTTCCAGATCACCAACTAGCCGTCGACAATTCTGGAGGCGAAGACGCTCGGTAACCCCTGCAAAATTGGTCTCGGTCATTGCGTTGGAGCAACAAC
CGGATGACATCACTCCTCCTCAAGCGGTCAATGATCCTAACGACACCATCGTCTTTCTCAACAACCCAACCACAGAATTTGATCTACGCTCGTACTTTTT
CAAGAAACAAAAGTCGGTCCGTACCATCGACCGACTCGAGAGGTCTGCAATCAACCAAAGCTCCGTCACGAGTTACAGGGGCAGCCATACCAACGAATTC
TCTTCCATCAACAACTCGTACAGAGGGGGATTGCCCTTCGGAACAAAACTGGAGGCTACGAACCAAAATCCAAATGCATTGTTCACACAAACCACAaaag
cacgacgacgactccgCGCGAGAGAAGAGTTGTGCATCGTGCTTCCTCGATCAGATTCCCGCGGACGAATGAATCTGCAAAAATCCTGGTTTCTCGGGCC
AGGATACATCGGTCGCGATCCTGGAGAAGGAACTCTTGTCGTCACAAAGGATAAATCGATGGACGCTGTTCATGCTGAAGTTTCAGTGTCGGGTGATGAC
TATTTCGTTCGTGATACCCAGAGTACAACGGGAACTTTTCTTTGCTTGAGTACACAAATCCGGCACTACCCACAGCGAGACGGTTTCCGTTTGCGCTCCG
GAGACGTCTTTCATATTGGACCAGCTACATCCATTCGTGTCCTGGATCTGCAAACCATCACTGTAGATCCCAATCAAGAAAAGAACAAATTTAATTTGTC
CTCAACCTCCATCTGCAGACCAGAGACGTTCATGCCAAAATGTGAGAGGATTATAGCTCAGCCTCCAACTCTCGAAAGCATTCCCAACACCAGCGGTGAA
ACCCCACAGTCGACGGTGAAACGAACGGCTACCGCCGTGGAGTTTCTTGCACCAGACATTGATGATAAGCTCACATATGGTGCAGGTCGAAGGCATCCAA
TGTCTACCTCACGAAATGGTGATTCAGTAGACAGCCAACCAATTGCACCCGAACAATCGAAACCACATCATACCGTGCATTTTGCAGACACACCTCctgt
catgctcgatggATCCATTTTCCTCGGTAGCCGCTATATTCGCCCCGCAACCATACATTATAGCGAGCCACCTCAGGTAGAAGATGAGGATGACGACATG
ATCAAGCAGCTAATTGGAAGCGAGAACGACACCTCTTCAAACACGAAAATTCGTCGGTCAGCTTCAGTTCGCCTGCAAATATTCCAATACGACTCCAACA
AAGCCAGCATTGAGCCTCTAAATTCTAGAGAGGCCCGCGAAGTCACGCTAATCGGTCAGAACATTTACCTCATTGGGTCTTCATCAGCTTGCGATGTTCG
TATTCTCCCATCCGAGGGTGTCGAAGTCCGAGAAATTCACGCTCGGATTATGTTTGATGGAGTAtcgttcgtgctgcaggacCTCTCATTTGAGCGTGAT
CCACGTAGACAAACCCGCGTACTGCTCACTCAAAGACCCGTACGAGTTACTCGTGGAgactggctgctgcttggtaCATGCACGCTGTACATAACAACAG
TAGCGAGAGCGATGGGCTCTGAGCGACGTCCCGATATGAAAGAGGCAGCTATGCGCCTGGACGTTTTGCGCTTGTCAAAACGAAAACCGAGGACCCGTGG
CATGTTCGTTCCTGTAGGCTTTCGGTTACTCTCTTCTTCCGGTTCAGGAGCTTCCAGCGGAAGTAGTGGATGGGGTGGTAGCAGTGGCGGGCCCGTAACA
TTTGGCAAAGGTCGAGATTGCGATGTACAAGTTTTTACGGCATCACTAGCCACCGAGCAGTTTAGCGTACAGCTTGAGCGTGGCACGTGTATGATCACTC
CTAAGCCCACGGGAATAAATGCTGGCACGTACTTCCTTATCGGGCGTGATGAAGCGGGGCCACCATACCCCGATACTGAAGCTGAAACCAATGAAGATGA
CACCATGGTAGAGAACTCAGCCGATATCGTCAAACATACAAGCaaaccgctgctgctctccgaAGGGTGCGTCTTCCGTTGTGGTGGATGCGAAGTGGGG
GTGATCTATTTGAAAAGCACAATCTCGACCGAAGTGAAGAGCACCAtcgaagagcaagagcacgtTCAGTTCTTGAGTAAAATACCATGGTTAAAACCCA
TTGCGTCCGATTCAAAGACAATCGCGAATGTTGCTCGCTGCGGCCAGAGGATGACACTGAGCCCCGGTGCCGTGGTATACGAAAAGGGTGATGGTGCAAA
CTTCGTGTTCATAGTACTCAGCGGTGAGGTAGCACTTGAGGTTACAGTGGACAACGTCGAACCCAGCAAGGATAACGGCAGACCGGTACTGGTCGAGCAA
GTGGCAGCTGGAGGCTTCTTTGGAGAAATGAGCTTGTACGACCCCGTCGATCGATACGCTTCGTCACCTAACACCGACGATCTTGAATATCTCGAAACTG
CGAAAGCTGCTACCGCTtgtgagctgctggttctggcGAGAAAAGATATCTGCGGGTACTTGGAGCTTTATATGGACATCATTCGTGCCCAACTGCGGCA
TGATCGGTGTCGGGACAGAATTATCAGAGTAGCATGCAGTCGAGTGCCGTGGTTGAAGGGAATTTCTCCCCAAGAGATGCGCACACTTTCAGCGCAAGCA
GAAGTTGTCGCTTATCCCCACGGGTCAACCTTGTTTGAAGACGGGAAGCTGTTTGTGCCTGCAGCTTTCGGTGGAGGTAGCACACTACAACTCCGTGATG
GCCTCCTTATTCTCAATCGTGGGAATGCACGGGTACTGAGGAGTAAGCATGAGAAACAATatcggtggaggaggaagataTACCacgctgaagacgtcga
agaaCGGGATCTTGAAACCGTACACGACATCTACGAAGCAAAGAACGAACCGGATGAATGGTGGAGCTCCATGGAACCAGTGATTGCgatgagctcgagc
tcgtctCCGTCAGTCCTGAGCTTTTGTGACTTGTCCTTTCGCCTTGATGCATGTTCCACAGTTGAGTGCTACTTCATAGCGGCGATACACTTCGCCGATC
TGAGCGTTGGCATCTCAACCAAAGAGCAGAACAACCCTAGTTCTAGCCCCGAGATATTCACTGCCGCTCATATTCTACCACCATTGAAGCGACGCAACTC
GAATGTGGCGCGGCGGATGCACCATTCGAAGGTAGTGACCAGTGCTTTACGAGATAGCGACAGTAACGGcgctgatgacgacgatcaTTCCTTGATGGAC
GGATCCGACGGAGAGGGAGATACCACTGCAGCACACCGCTGGAGACGTAAGAAGCGCAACAAAGATCTTCTGGAACAAACTGTACTGCAGACGAAGAATG
ATGCACAAATACCAAATGCGATGGTGCTGTACCTACTAGCGGGAGCGCAGCGCGGGGACATCCATGTTGTCCGTAATGTGGCATCCATAGGTGGGCTTCT
CAGTGGAGCGGACATTGAACTCAATGATAGGTACGTCTCTCCCAAGCACGCTGTCATTGAATACCACGACTCCAGATATTGGCTATATgacaacggcagc
aagtgGGGGACCTTCGTTCGActcgaggaagagaacgCCGTCGACATCAATCCAGGCGATGTCTTTTTGGCTGGCGAGGTTGAGTTCACATGCCTGGCTT
CGTACCCGGAGCGAAACAAACCCAGCATGTGCTGCATAATGTGAGCAAGCCATAAAATAGTAGACTGTAAGATAGCAACCTGTGAATAGAGCACCTACTT
GACCAGAGAACAATATTCACCTTATTAGGCAGTCTTACAAGgtgacggcggcggtgcgACTAGCACATGTGCTAGTACGTTTGCTTGAATGAATTCCTGG
CCTGATCGCATATCGACGCAAACAGGTCCACCCAAAGCCTGAAGGCCACCCACCACTGGCAGGAATTCAACCCATACTGTTTTCGCAGTCTTGGCTTCCA
GCATGTCAAGGTTCTATTTCAGCCAAGCAAGCAACATAAAAAACAGTCGTCATAAATCCCAGTCCCCAATCAGCAGAAACCAAGGGGCTCCAACATACCT
GATGGGATGCTGCCGAACACACAATGCCATGCATAAGTTCTTTGCGGAAttgcagttgcagtctcAAACTTCGTGCTGACGTGTTGGTCACAGACACAGC
AGCCAGGAACGGCTGCCCAACCACCACTTCTTTCGGCAACTCCTCAACGACAACCGTGATATCACTCTGCTGTCCTGCCCCAACTCCAGCGTGGCCAGCA
GTACCAGGAACTTTTCGCATTACCGGTTGGCTCTGCACCGATCCTGCTTCTCCCATCGACGTTTTCCACCCAACATGAAGTCGCCCAAGGTTCTGGGAGC
CCTACAAGGAGAATTTACAGGTTAAAACTCCCCATCTCGAGAGCCAACTAGCAACACAAAATACCTGATTTGCCAACAGAGTCGGGTCCGACGCGGGGTC
ATACGAGACCCTGAACACGCGCTGAAGTTCCTCCTGGGGGTACACAAGCGTCTGGGGTCCGTTATTTAGCGACAACAAGTCTTGAATCGAAgattcttct
ccatcttttTTGGCGACCTTGTTCACTTGCATTTCTTCCAACGTGAACGGTGCTAACGGTAGGAACTTTATACTGTCCACGAAGAGCGGGAGCTTGGACA
CGTTGCGAATCTGCGCCTCCACGATTGATTCTCCCTGTTGCTGGTAGGTCGCCACCGAGTTCTGCTTGAACGTAATCACCAACGGGTTCTGCACAGCGAA
CCGGTAGAATTTCCGCAAAGACTTGCTCTCGCCCGTGATAGGGTCCACATAGGCCACTCCAACACGTAGAACGTGGTTCCCCACTTGGTTCAGTGGATAA
TCCACCACCATATCCAGACTGGAGCCAGCaggcagcactgcaacaggATTAGGCGGAGGCATCTTCCCCGTTCTCGCATATCGAttgtcgtgcagctcca
cgcggTCATTGGCGCATTGAATATTGGCCGACAGCCCCACGTCGCGCAGTTCACACGAGTACGGGTTGATAACACTGATGTAGCTGCTGAAGGTGTTGCC
CAGGAAGATTTCTCTGTGATAAAATAATCCATAAACAAGTATTCCAATTAAGAAAAATGCTAAGATACAAGACTTTTGTTGTTTTTGACGCACCCGAAGC
TGTCGGGCAGGATGAGCGTACTGGACAGCGCGAACTCGTGTTGTGTGGCAGTAGCTTCGGCCATGGATGTGGGCAGCATGGAACCCCCACTGGCGCCTTG
GACGTAGAGCTTGGGTTTGTACAGTCGCATCACTATAATATAACACCAGAGCATTCAATCAATGGATATTCCATTATAGAAGACGCAATAACCACGCAAC
ACACCCTTCAGCGTTGGCTGCACAGTAGACGAACGAGCTGATGGCGCCCCATCCGCTGTTTTCACTATTGGGGCGCCGCCGCCGGAGGAAGGAGGGCCGC
TGTACGAGGAGCTCATTTTTTCGATGACGGATAAATGATTTTATGTGCGGCACACGAAACGTACGTGGTGCACATCACACGCTTCAATCATATCGGCCGC
TCATTCGCCAAGTCTTAAGACccaagacaagaagatgctggctCGCTCGCTGTTCCGTGCCGCCTCGAGCGCGCGCAAGTCAccgtcgctggctgctgcc
tccGCCAACTTCGTCGCCACGCAAGTTGCGCGCTTCTCCGACGCCCCCACTGTAATAAATAAATGATGCTAGAGAAATTACGTAATCATCGTGAATTCTT
CTTACACAGTGTCTGTCATTGGCTTTAGATGCACGGCACGACGATCCTGTGCGTGCGCAAGGGAGGAAAAGTGGTGCGTTGCGTAAATCGATGTTGTCAC
TGCTGAAACGAAAGGATATGACAGCTGATTCGTGCTGTGTCTCCTTTAATTCTGAGCAGTGCTTGATCGGAGACGGCCAGGTGTCGCTGGGCCACACGGT
GGTCAAGCCCAATGCCAAGAAGGTGCGTCGCATCGGCGAGCATATTGTGGCGGGCTTTGCCGGCTCTACGGCCGACGCCTTCACGCTCATGGAGCGTCTG
GAagccaagctggacgagtaccCGGGACAGCTCACTCGCTCGtgcgtggagctggccaaggctTGGCGGACGGACAAGTACTTGCGTCATCTGGAAGCAA
TCCTCATTGTCGCAGATGCTAAGCAGTCGTACACGTTGACGGGCAACGGAGACGTGGTGGAGCCTCACGACGGCATCATCGGCATCGGATCGGGAGGCAC
TTACGCTCTGGGTATGTAATCTGTTGTTTTCTCTTCAGGTTTTGAGGAAATGATCAACTAAGCGTATGATATTGTTTGACTGTTGCAGCGGCCGCCCGTG
CTCTAATCGATCAGGACCTGGACGCCGAGACGATCGCTCGCAAGTCTATGAAGATTGCGGCGGACATTTGTGTCTACACGAACGAGAACTTTActgtgga
gatgctggaagCGGGCAAGGATGACgttgaggagaagaaggagtaGGAGATGTAACCTACAAGTTGCATCCTGTAAAGCATTTTGTAgagattctgcagc
aatgcCGGAATCAATAAATTTGCAGAAGTTACTCGCATTGCTGTTCTTGTTCGATCGACGTGTGTGAACAACGCAAGAGAAAATAAGGCGTTGTAAAAAT
ATGGCAATATCATAATCATGTAGAGGAAGATAGGAGAACAATAACAGTGGTGACAACGTCAACGGCACATGCTCGATAAATGCTACTCGTTTTCGTCGAC
TGTATCGTCTTCTTTCGCATGGTACAGTTTGTGTTCGTTATAGCCCGCTGCACCTTGATCCTCTAGTTCCTTGCTACTCGAAAATCGCGATGGTGGGTAG
GTTGGAAGGCGTGTATAAATGTATTGGTGCGCTAGTGCGCTATCTTGTGTTCCTGCTCCTGATTAAatgttgttggcgatgaccGAGTTGTACTTGTCGA
TGTTGCGCTTCAGGATGTCTTCTAGCGGGCCCATAACCCGCTTAAACGTTTTACGGTCCAATGTGAGGCACTTGACCTTGCCCTTGGCTGTCACCGTAGC
CTGGCGCGGTCGAGTCGTGAGCAGTGCGATTTCGCCGAAGTAAGCACCTGACGTAAGCTCTCCCATTTCCGTAGGCGGATCCGCGGGTGAGAGCTGCTTC
GTACACACTGCTGTGCCTTCTTCAATAATGTAGAACAGGTTACCGTCATCACCTTGTGTGATGATGACTTCGCCCTCACTAAACGTCTCTGTCTTGAGTG
CATCTGCAACAGTGAGACGCTCATATTCGCTCAGAGATTCCAACAGCGGGACACGCTCAATGAAGCCCTTGTGTGCCTCGCGCTTCTTTAATGTCGTCTC
CATGATGATGAACTTGAAAGTTTGGCGATCCAATGCCCATGCTTTGGAGTGTTGCACCGCCTTCACAGTTGCAGCACGCGGAGCGTTGTACATGAGTGCC
AGCTCGCCAAACGACATAGCCTCTGTGCACTGCATTGCCAAAGCAACAAAAGATTTAGCACCACGACGTGGAAAATGAGCAAACACAAGCACAACGCACC
GTTTGTACGAGGATATCGTCTTTATAAACTTCGCAGACGCCGCTCTCCAGGATGTAAAAGttgtctccgtcgtctcccTGCTTGATGATGATGTCGCCGG
GCTCGAACTCCTTGGGGAACATGGCGTCGAGCACAATatcgtgctgcttctcatccagcgacttgaacaAGAtgttctccaccaccatgcGGCTAATGCC
CTCCCTCTCCTCAGCAGACTTGGGGTGCACCACGCGCTCAGACCGCCGTGCACTGCCGCGTCACATACAGAACAAGAAGAGGTCAATTAAATCAGACAAG
ACGCATCCTCGTCCACacagaaagcagcagcactaacCTCAACGGGTCGATGGTTTCAGCGGACACGGAAGTACGCCGTCCCTTGGCCATGATCTTGGGT
GGCGGTGCGCTCACTGCAATCTCGCCcacagcgtctccaccttcgtcttcgtcttcgctctcgctctcgtccgaGTGATCTGCAAAAACACGAAAAATCT
TCGTTAgatcttctcctcttctgATCTATGATCGTTCTCCTCCCTCTCTCTGCCATCCGAAATCTAAAACCAAACCGTCGCGTACATTGCAAATGGGGAG
ACGCCGCCGGGTTGTCGTGTTTGTCCCCAGGCTTGCGGCGCGGCGTGGCCTCCTCCGGGTAGTTGGTCTGCAGGTACTGGATGATGTGCAGGATGGGGTT
CTCGggcttggccagcagcagcgactccacCAGGTTGATGAACAGCGTGTTGATGCCCTTCTTGTGCAGGTaatcctgcagctcctgctgtaCACCCTCT
GCGTCCGTcattgctgctctgctctgcttcggcttcggAGTCTGTCTTGTTGCGGTAGTGAGAGCTTGGTCGCTCACTTGCGGTCGCTCGCTCGTCTCGG
AGCGCCGGGAACTAAACTGAGGCTGGCGTCACGGGCCTTCACTCCAAAATGGAAGAAACTGCTGCTCGCGTGGAGGaaaaaacagcaacagacgCTGAAC
CCACACACGAAAGATCGCTgtcttgttgctgtcgcgC