Description :
From Genome Similarity Track
Location :
Scaffold_141:967- 4432
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_141-fgenesh-gene-0.0Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_141-fgenesh-gene-0.5Serine protease family S10

Sequence
3465 bases(100 bases per row)
GCGTACGGCGCAAAGGCGTTCACGGCGCTGCTGCTGGCGTCGCGAAAGTGGAGCTCGATGGAGTACGGATACGTTGACGCCGTGCGGCTCTTGCTGCGTC
TCGACACGATCCGCTTTGGCGCTTTCTTTGGAAGCCTCGTGGGCGTGTTCCGCGTCACGGAAATCGCAGCGCGCAACGCTCGCGGCAAGAAAGACGAGAA
GAACCTCGCGATCGCTGGTACGTACGTCAGTTATGTGGTGGATATACCAAGCTTTGTGTGGATGGATGGCTTCTGACAAGATCGAGTCTGTGTATGATAA
ACTATAGGCGCGGTGTCCGGACTGACGCTCCTCGTGGACTCCAAGGACCGCCGAAGCACCATCTCGCTCTACATCTTCGTGCGCATGCTCGACGTGGTCG
GACGCCACCTCACATCCACGGGCGTGTTGCCCGCGTGGGAGTACTCGTCCGAGTTCCTCTTCGCGCTCAGCAACTCGGCGATCATGTACGCATTCATCAT
CCAGCCCAGCTTGCTGCCAAAGGTACCTCTTTTTATATCAGTCATTGTTCTAGTCTACTATTCATGTCTAACGGTTTCTCTTGACATGAATGGCGTTATG
TATTTCTCCTTGGCAATCTGTAGAGCTACTACAACTGGATCTTAAACATCGGGGCGGTGACGCATCATGGGCTCGAGTACACGATTCGCGACCGGCTCTT
CGGCGCTGTTGATGAAAACGGCGTGCCTGTCCCGTTCCGCGTCTGCCAACCGCATTACCATGTGTATGTGCTTGTCTGGCCACCATGCAGGTGCCTCATG
ACTATCCACCAAATACTGCGTAGCTAACACTGTGTTTTGCGTTTGTGTAGCGAGTCGTGTATGACTCACAACGTGAAAGAGTGGATCCATGGGCTGGGGC
GAGCAGCGCAAGTGTACCTGCCCGTGCACATACTGCCGGCGCTGATCTTCCGCTTCCAGCAGATCAAAGGCGCGCCTCTGTCGTCTGCCGGAAGGATCTC
GTACGCCGCGCTCTGCTCATGCCTGTTTCTGACATCCTACCAGGTGAGTTCCTACTTACTGTTGGCTTGGTGGCTTCATAGTGATCAGCCAATAGATGCA
TATGCTAACGTTCATTCTTTCCTTGAACGGTACAGACTATCGTGAAATTCATGATGTGCACGATCCGCAACACATTCCAGCGAGATTTCCACATTGCTGG
CTGGATATCTGGGGTATGCAATACCTGCCATTCCGCGTCCCTCAGTGGAAACCATTGTGATCTCATCCAAATTGTGTGCTTGCGATTGTTACAGTTCGCT
ACTGGCGCGGCGCTGTTCCTCGAGAACCGAAAGCGCCGGTCGGAGCTAATGCTCTACTGCCTCATCCGCGCGCTCGACATTGTGTGGCAGCTGCTCAAGC
GCCGTGGACTCGTGCGCTACGTTAAGCACAGCGAAGTGGTCCTCTTCTCGCTCTCGCTCGCCGCGATCATGTCGAGCCCGCCGGAGCACTTCAAGCCCAC
GTACCTCCGCATCCTGCGCTTCGTTTTTGGTCGCAACATTATTTAAAAGAAGAGGTAGGAGGAGCGTAAAAGCACAAAAGAGCGCGCGCGCGCGAGAGAG
AGAGGAACTGTGGCATCCCATCAGAAGAATGAAAGACAAGAAATCGTGATGCGCAACATCTCGAAAATGGTCCATAATGACACCACTACAGTGGAAAGAA
AATCAAGGTAGGTTCTTCGTGAGGTGGGGAGTAGTAAGCACCCCACCAACCATTGTATCGGATACATATTGGCAAATGGAAAAATGGAAAAATGATAAAA
CTCGAAACTCGCATTCACCTTGTTTACAAATGCAATTGATGCAACCTCTCTGTCACAGCCTCATCCATCACTCAAGTCACTGGGCACTCACTCATTCTGC
TACCCTTCGCGCTCGAGGATGAAGATGTCGAGCATGCGCTTGGCCTCCACGGGCTTCCATTGCGGCACCAGGTGGCCCGCACCCTTGACCGTCACATATC
TCAACCCCTTGAATTCCTCCACGAAGCCGNNNNNNNNNNNNNNNNNNNNNNNCACCTCGACCATCCATGGAGCGCGCTTGCCCTCACGCTGCAGATTGAG
CGACTCGACAGCCCAGAGCCCGCCGATGAAGTCGCAAACCATGTCGGCGTCACCGTGGTAGATCACACCTTCGACGCCGTGCGCGAGAAGGTACTTCCAG
ATCGGCGTCACCTGCGACTGCAGCGTGCTCGAGTAGTCGAGCAGCTGCGCGTTGCCGAGCTTCTCCTGGTCGATGCCGAGCAGCCCCGCGCTCATCTTCA
TCGACGACGTCGTGAGCGCGTCGCCGTACCAGCGGTCGATCTCCNNNNNNNNNNNNNNNNNNNNNNNNNGTGTGGAACGCGCTACGCACCTCGTCCAGGT
TAAAGTAGACGTCAAGCTGCGTCGAGTTGAGGCACATGGTCATCGGGTTGCCGATTGGGTGCGGAAGCCCGTTCTGCGGGGTCATGAGTGCCTGCATAAG
CTCCTTCACGCCCTCTTCCGTGGTCCCCGCGCACGTGCCGTACACGTTGTACATGTTGATGTGGTTGAACACGAGCTTCGCCATGACGTTGAGCGTACTC
TCGCTGCACTTCGGGTCCGCGGCCGGGTCAAAGAAGCTCGCGCTCGGCTGGTACTCCTGGAAGTGTGGGCAATCGGACCGCACTTGCTGGTATTCCTGAG
TGCTGATCAAGCCGTGGTAGTACGCGTACAGGATGATCGAGAGCCCCGAGAACTCGTTCATGCCGTTGCCGACCACAAACTTCTTGAGGTTGATCTTTGG
CAAGTCGCCCTTGAGATTGCCGTTCACGATTGCGCGCGCAGTCGTCGGTACGTAGATGCCGCCGTAGCTCTCGCCCGAGATGATGAAGTCGTTCTCGCGC
AGGTGCGGGAACTTGGTGAAGAACTGCTGGAGCCCGTCGTACAAATCCTCGGCCTGCGATAGATCGTCCGAGACGTACTCGCCACTGGCGTTGTAGCTGA
AGCCCACACCGATCGGCGACTCGATGCAGATGAAGTTGGCGTTCTTGTTCCAGCCGTACTCGTTCACGACCAGCTTCTCGCCGTCCGCGCTCACGAGCAG
CGNNNNNNNNNNGCGTCGTACAGATCGTCGGCCTGCGAGAGATCGTCCGCGACGTACACGCCACTCGAATTGTAGCTGAAGCCCACGCCGACGGGCGACT
CGATGCAGAGCAAGTGCGCGTTCTTGTTCCACGCGTACTCGTTCACGCGCACGCTCTGTCCGTCGTCGTTCACGAGCAACGGACCGTTCTCAGTGAAGCA
ACCCGCGAGTGAGCTCGCACCGGGGCCGCCGTTCAGCCAGAGCAGGACCGGGTCCTTCTCTAGCACTTCTTCACTCTGCGACTCGGCGAGGAAGTAGAAC
GCCTCGCCGCCGTTGGCGAGCGGCAGGTAGCCCGAGAACAGGCGCGCGCTGTAGTCGTCCGGCTT