Description :
From Genome Similarity Track
Location :
Scaffold_1453:967- 2044
Transcript NameFunction/comments
Phyke_g11879ATP-binding Cassette (ABC) Superfamily

Sequence
1077 bases(100 bases per row)
CGCGACTAGTGATACCAATCCGTTGACACACGACAAAGCTCTGTCCTACTTGGATCTCTACCGCTTCGCCACTCCTTCCGACAAATTGCAGCTGATTTTA
GGCGCGACCTTTGCAGGTCTCAATGGTGCCATCTTCCCGTGCATGGCGTTGGTCTTTGGCACTGCCATTGACGCCTTTGCACAGACCGATGGAGGTGTGG
ATCGAACCGCAGTGAACCGTGCAGCTCTGTACTATTTCTTGATTGCAATTGCACTGTTCGTGACAGATTGCATGGCTTTTATTCTATTCTGCAACTCGGC
AgagaagcagatgaaggcgttgagAGCACAGGTGTTCGCTCATATGCTCTATATGGACGTGAGTTGGTACGACAGCAGTGACGTCTTCGAGCTGTCCAGT
CGAATCACGGGGGACACTGTTAAAATTAAGGACGGCATGGGGCAGAAACTCAGCGACTCCATCAAATTCACCGTCCAGTTCTTTGTGGGCTACATCATCG
GATTTGCAAGAGGCTGGGATATGAGTTTGGTCATGGCTTGTGCCATGCCCTTCATGGTGCTCTCGCTGAAGTATATGGTTCGGCTCTTCCGGAAACGCGC
ACTGTTGTCGCAAAAAATGtatgctgaagctggtgccgtCGCTGAGGAAACGCTCGGATCGATTCGCACAGTGGCCTCGTTGAATGGCGAGAAGCGTGCG
ATCGACAAATACAACGAGCGAGCTGTGCTCGTGGAGACTGGCAACATCGCCGTTTCCAAACGCTCTGCCTGTGTATTTGGTTGTATGATGGGGAGTGTGT
GGCTGATGTATGCGGCTGGGCTTTGGTATGGTGGATCCAAGGTTGCGAGGGATGAGGCATCGCCAGGAACGGTGTTTCAAGCATTTTTTGGCGTGTTAAT
GGGAACCATTTCTCTCTCACAGATCTCGCCAAATATCACTGCTGTAGCAGAAGCCAAGGGTGCTGCGACTGAGATCTACAAAATTCTTGATACGCCTTCA
ACCATTGACGCCTCCCAAGACGTCGGTGACAAACCGGACTCCTGCTCCGGCCGCATCGAAGTTCTCAACGTCAACTT