Description :
From Genome Similarity Track
Location :
Scaffold_190:967- 1976
Transcript NameFunction/comments
g15460.t1hypothetical protein

Sequence
1009 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
ACCCAATGAAGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTAAA
TTAATTTGTGTTTCCCCTGCCGGTGTTATCGGCGTTCAATAGCAGCTTCTGTTGATCGACAGAAGCTGCTATTGCGTCCTGAACAAACCGAATTACGGCT
TGTCGGCGCTGGACAAAGTTCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGTTGTTCGTTGT
CGTTTGAAGTGTCTACGCCCGTCGTAGACACTGTGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTACTTGTATC
AGCGTGCTTATCCGGTTGTTTTGAATTAACCGAGTACCCTCCCCCACTTAAGGAAGGAACTACCGCTCCGAGTACGCTCGGTACGCGTGGGTGCCTCATG
GCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAATTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGT
GCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAGCTGCGTCCC
AAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCG
ACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGTGGTCAACAAAGACCACAATACCAGTCC
TCCGCTTGT