Description :
From Genome Similarity Track
Location :
Scaffold_57:96677- 98638
Sequence
1961 bases(100 bases per row)
GGCTTCTAGCGCCCACGATGAGCGCGGGTACGGAGTGTCGTCAACGTCCGTACTCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCT
TCTGTTCCCAGATTGCGACAGCCTTCGGGCGGTCTATCAGGAGACACGGAATTGGCTCCCACGAGCTCTCGGAGTGGGCATAACCCTCCACTACACAAGG
AGCTGTCGCTTACCGTGACGCCGTTGCTCCTGGAGAATCCGCTCCACGTGGTAGTGGACTTCTCCATTTCGGTTAAGTAGGGGCAGAGGTGTCCTCGTAC
GAGTTAGAGTACTCGGCGCCTCCCGAACGCTACTCTCGGCCGAGCGCTTCTCCTGCGGGTCCGACGCAGGTACCTGAGGTTGACCGCCTCCGTCAACGCG
TCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACCGGCGGTGCTGCTGCCGTCCAAACCGGGAATCAGACGTGCTAACTCGGCTGGCGGGCCGCCTGGAC
CAGCTGGAGCGGGCTGTAGCCTGCATCTATGGGTGGAGCGTCGGGCCTCTTCGTCCGATCTTGACACGGCCTTCCGCATGATGTGACGTGTTGAGGCTCT
GCTGCCACGTCCAGAGCCGCATTCGGCGCACCCCCAGTCGTACGCGTATGGTGCGTACCCGACGTACTCGGCTTACTCAGTGTATGGCTCTGGGGCCCGC
TCGTACGGGGTCCGGCGTACGGTCTTGACCGCAGCCATGCTGTTCAGACCGAGGCTGAAGTACCTGCTCCGACGCCCTCGTCGACGTCTATGGCCGGCCC
TCGATTCGAGGAGCTTGGCCAAGGTGGGTCTGCGAGTCAGCAACCCCCTGCGGATCAAAGTACCGCTTAAGACGTCCAACATAGAACGTTGGGTGCGTCA
TTGACTTAGGCAGGTCGATGGTGTACGACGCACCATGCCTGGCCAGGACTGCGAATGGTCCAATAAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCT
GACTGTGTCTAGAGGTAGATTCCTCGTGTCTAATAGCACTAAGCCCCCCACATTAAATACGCTTAAGTTTCCTCTTCGATGTTTGCCCGAGTACTCCTTT
TGTCTATCCTGGGCCGCTGACATGGCATCGCGGACACTGCTGACAACGCTCAGCTTGATATCCACAAAGGATTCCACTTGTTTCCGCAGCGAAATTGGTC
TCACATCTGAGACCTGGGAGGATAGAGCTTTCCGAGCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACGGAAGCCGTT
CAAGAGGAACGGCGTGAACCCCGTGGACGCGTGGGCTGCGTTGTTGAGCGCAAACCCAACAACTGGAAGCTGCGTCGACCACGTACGTAGTGCTTCCGCG
CACACACTGCGCAGTGTGTCCTCGACCACTCGATTGACGCGCTCTGTCTAGCCATCTGTCTTTGGATGGTCCGCAGTGGGCATCTGCAGGCGAGTTCCCA
GTAAAGGAAACAACGTTTTCCAAAACGCAGCCGTATACCGCGGGTCTCAGTCCGAGCCGATCGTCTTCGGGAGACCGTGATAGCGGAACACACCATCGAC
GAACAATCTTGCGGTTTGTTCGCCCGTAACCGTAACGAAAACAGTAGCAAGATGGTGTATCTTGCTTAGCCGACACACGAACACCAAAATGCCGGTGTTG
CCGTGTCCGTCGGAGGGAAGCCCAAAGATGAAGTCAAGCGTCATCGACTTCCAACAGTCAGCCGGTACGGGCAAGCTCTGTGATGGAGTCGAACCGTGCC
ATGCGGGTTTGACCCGCTGCCATGCTTCACATGTCTTCACGGATCGGGCGACCCACCTGTACATGTGGGTCCACCAGAAGACCTGAGAGACCGAAAGGAG
GTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCGTGTGCCTCCGCGAGGATATCGA