Description :
From Genome Similarity Track
Location :
Scaffold_23:966632- 974574
Transcript NameFunction/comments
Phyin_T30-4PITG_11374Putative uncharacterized protein

Sequence
7942 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNAAAAAGCTCATTTCAGTTGTGCACTCTATTTTATTTAATATGTATATAACTTTAATAGAAGACCTCTCAAAATACAAAATTGC
CGATCTAAGCTTTATCGAGCCAAAGATGAAGTCACAGATCAAGGTGAAGCAGAATGGAATTCTTCATTTGGTGGACTACCCTTTATTCTTGCTGAGATCC
GTGATGCAAACCACTGCAGTATATTTAGCAGTCGATCAACACCAGCGATTCTTACTTGTTATTATAGCTTTTAGAGTCAATATTTCTGGACAATTTGCAC
TTTTGCCAATACTTGAATTTGATGGAGCCCACAGTAAACATCCCATATATAATGGTATTATATTATCTCTCATTGGACTAGATTGAAATGGCCAAAACGT
GACACTGGCTACTGCTCTTGTGAACGTGGAAGGAGAAGACAACTGTGTTTGGTTTTAAGAGGAATGTCATTTTGCAGGAATTGAGCTTAAAGTGCGAACA
GTGATCTATGATAGAGGCAAACGGATTGGAGCTGTAGAGATATTCCGAGCTCGACACGGCGTTTGGTAAATTTACGCTTTTGTACAGTCCACTTGCTCCG
AAACATGAAAAAACATTTTAGATTACATGGACAAGCTTCCAAAAACGCTATTTGGAATATTCAAAGTGTCGAAACGCAAAGTGAGTTTGCAGTTGCTCTT
GTGAAAGTTCGTCGTGATTATGAAGATCCAGTCGGAAACTACATATCCTCAATCCTCAGTGATTATTGGACTGTTCATGCGAACCTACCCTCGTTCGCTC
CAGGACCCAATATAATACCGCCCGTAAAATTTCCTATATCTACTCTCAATGATCAGCTACCGACGCGTCAAGAACCCGTTACTATTCAAGTTATACCGAA
GGTGTCCCCGACGTCTTTGAGTCTACCTCTTTTCGGGTGGCGGAGTACATGTGACGGGATCACACAGCACCTTGCGTAGAGGAAGTTAGCTTCCGAGAGT
ATACAAACTCTCAGTGAAAGGCAGTTCACATGTCCCCTCTTTATCAAAAGAGAGCGAAGTGACCTATTTAAGGTAGAATGTAAACTAAGTATATTTATAG
GTAGATAAAGCTTGGGTTTAATACAAACTATAAGTCACCTATAGAAATGCAATGTCACCAGCCAATGGTTGGCTTTGGACGACCTTGGTACCTTGTACCA
AATATCCCGGAGTATGACTGTCATACTTCTGAAGTGTGACGTGTAACACTTCATGTAACTAGGGGCACACTTAGGGCTACGTACCCCGTTACACCCTCCC
CCACTTAGGTTTGGTCTACCGACCAATCAGAATGAAGAAGTGTTCGTCACAAACTTTCATTCTTAAAGTCGAAAACCATCGATTTGGCCGCACGAGCGCG
ACCGAGGCTCACTTCACAGTTAGCGCCTCGAGCAGCAGTCAGTGCGCTCTTCTTCTAGGTTTTCCACTTCGACCGTTAGCCATGCCTCGTGGCACTGCAA
AGAGCGGTGCGAAGACACGCTCTAAGGCTGCTGCCGGAAAGGCGCAAGCCAAGAGCACTAAGCCTCACGGCAAGGGCTCTGCACTTCAGGAGGCTACTCA
GGTGGCCTCCGAGGCGATCGGTTCCTCGGGTGACGCGGCTGTGGGCAAGCGAGCAGGCAAGCGCCGCAGCCCGTCGCCCTCGGCCTCTCCAGACAACCGT
TCGAACCCTCGGTTCGCTGAACGTGAGTTCGACTCTGGCAGTGAGGACGAAGCCGAGTTCGAGAGCACGCACAATGATCTTGCGGACTCTGCGAGAGGGC
ACAGCCCAGTGCCCAGCGAGCACAAGGACGACAGCGTGCAGTCGCTCGCTAGTGATCAAGGTGATCACAGTCCCAGGACGTCTGTGCGCTCTGAGAGTCC
GGCCGTCAAGGCTAAGGACACTCCCATGCCGGTGGCGATGAGGAAGAGAAATCTTGCAAGCGTCTCTCGCTTGCCGAGGGTCTTGCGCGTGCTAAGGCCC
ATAAAGCCGAAGGCGCCAAGCCCTCTAAGAAGCGTACAGCTTCTAAGTCTCCACTCCGCGAGGAGATGGAGACTCGGTACCCCCATCGGGGCCTCTTCGA
CGCCTCGGATGAAGAGGAAGAGAAGGAGGAGGAAGAGGGTGCTATCTCTTAACCCCGGGAGATCACGAATGACCTCGACCAGCAGCAGGAGGACTTCCAA
GCTGCCCAGCGTGTGCGTGGGGGTCCGGTAGTGGCACCCGCCAGCCAGGGAGCTGCCATCAACTCGCGAGGGTATTGGCCTCCCGAGGAGAGCGCTGGGG
CTGACCTTTTCCTGGAGCTTCTCGTTGCTCCTCGTGGCTTTGCTGGTGGCCACACCTCTAAAGGTATTTACGGGCGTACTCTTGTTCAGAAAGAACAGTT
GTTTGTTGACAACTTGGAGGCTTCTCGATGTGTGCTTCTCGCGCCACGCCGCACCCCTCTCAAGGACTTCACTACGTGTCGTAAGAAGCCCGAGAACCGG
GGTGGTCTTTACCCTCTTTGGGGCTACCCCTGGCTTCTGCCCGAGAACTGTCCCACCTGGAGTTCTTGTGAGGACATGTTCTGGGCTTGGGTTGAGTCTC
TCAAGTATTCACCCACGGCGTTACGGGAACTCCATGAAGATCAGCTATTGTCCTGCATCCTGAACCAGCGTAATCTTCGTGTTCGGTTTGCCCTCATGGT
CAGCAAGCGCGTGCTGCCAAAGGACACCCCGAAGCGCGCGGCTTCTAGCGCTCATGATGAGCGCGGGTACGGAGTGTCTTCAACGTCCGCACCCCGTTCG
GGCAAGAAGCCCCAGACTACTTATGAAACTGCCGCCGCTTCTGCTCCCAGATTGCGACTGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCA
CGAATTCTCGGAGTGGGCATAACCCCTCCATTTCACGAGGAGCTTTCGCTTACCGCGACGTTGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGCCC
TCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTATGAGTACTCGGCGCCTCCCGAACGCCACTCTCGACCTAGTCCTTCTACTGCGGAT
CCGACACAGGGCCCTGAGGTTGACCGCCTCCGTCAACGAGTTCTCGTGCTTGAGATCGCACTTAGCCTTGGGACTGGCGGCGATGCTGCCACTCAGGCCG
GAAATCAGGGCGAGCTCGCTCGTCTTGCGGGACGCCCGGAGCTGTTGGAGCGAGAGATCGCGAGCCTTCATCTGCGGGTGGATCGCCGGGCCGCTTCGTC
CGATCTGGACGAGGCCTTCCGCGTGATCCGACGGATTGAGGCTCTGTTGCCTCGCCCGGAGCCGCCTTCGACGCACTCCCAGACGTACGCGTATGGTGCG
TACCCGGCGTACTCATCGTACTCGGCGTATTGCTCCGGGGTCCTTTCGTACGGAGCCCCTCTCGCGTACGGTCTTGACCGCAGCTTTGCCGTCCAGACCA
AGGCTTGGGCGCCTGCTCTGACGCCCTCGTCGACGTCTGTGACCGGCCCTCGCTTTGAGGAGCTGGGTTAAGGTGGGTCTGCGAGTCAGCAACCCCCTGC
GGATCAAAGTACCGCTTAAGACGTCCAATATAGTGTGTCTGGTGCGTCGTCATTGACTTGGGCAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGA
CCGCAAATATTACGATGAAGCGGTGCTTCAGCTTGTTGCTGCCAACAGAGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAATAACACTAAGTCCCC
TTCTTTAAATACACTTCAGCTTCCTCTTCCATGTTTGTCCGAGTACTCCTTTTGTCTATCCGGGGCCGCTGCCATGGCATCGCCGACCCTGCTGACAATG
CTCAGCTTGGTATCCATAAAGGATCCCACTTGTTCCGCAGCGGAACTGGTCTAACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAACCTCTCCCCCACT
TAGAATAGAGGAGTTAGTGTCTCCTCGAAGAGTTAGAGACACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAGCCCCGTGGACGCATGCACC
GCATTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCACACACACTGATAAACGTTGTGTTTTGTATGTAGGGTA
CGTTTGATGTATATTTCTCCGGAGTATTAATTAATTAAGAAATCTACTGGCATGCGACGTGAATTTCCTGTGGCTTGAAATGTAGAAGGTCCTTCTGCAG
GTAATGGTGCCGCTGTGCTCACTTGACGACCGGAAATTATATTACGTAAATTCTGGAGGGATATCGCATGCGGTATCAATTGTGAGTTAGCTAAATCCGA
ATCATTACTGTGCCTTCTGCACGTCCGTTGGTTATGGCCAGCTGCACTAAAAGTTTTACACTTGTAGGCTATCCCTATACTGTCCTCACTACGACTCGCA
ATATGTCGGGTAACACGACGCCCGGCTTGCTTGTAAAAAGGTGATGGAAGTACAGTGATGCTAGCAATGTTGGTGTGGCGAACAGGTAATTCAATCCTCT
CCCGGAAAAGGCATGTGCATTTGTCGCAACCAAATAACTTGGATGAAAAGCATTTATGCTGTGTTCTTGTAGACCACAATAATTCAGCACAGCATTGATG
TGACGACAAGAAATTTTTAACTGGTCGAAAGCTGGACATGAACATGACGGGGCGGTAATATCAACTCGTCGATCTCGGGCCGACCCGCATCGAGAAGCAA
AATACTTATTGAAGTGCTTCTTCTAACTTGATACTCTCCAATCCGAGCCCGTTCATTTTCCGACAGACCCTTGACATGAAGGGTTAAACTCCGTTTCTGT
TTCATCCAGTTTAATATATCCAAGTCACGTTTACTGGATCTTCTCATTTCCACCGCTGCAATCTTATAAAATGCCCAAAAGGACCTGCATCCCGGATACC
ATTCTAGATCATGGAGCTGTTTTCACTTTCGACAAAGTTTGTACTATAACGGGGTTCGTAGCCCTAAGTGTACCCCTGGTTACATCAAATGTGACACGTC
ATACGCCGGGATATTTGGTACATGGTACCAAGGTCGTCCAAAGCCAACTATTGGCTGGTGACATTGCATTTCTCCCACCTCTTCACTAAATTCAATTCTG
TCAGACCATTTGACGATAAATCGCTGAAAATTAAACGAAACTACTATAGTCAGCTCAATTTTGACAGGAATCTGTAAATTGCTAACGGCACGTTCAGCAA
AATAGGATTAGTAAAGTCTTTGTTTTGGAAGTTTCAGTCCACATTGGCAATGGCATAGCAAGATAAGACTACCTTCAGGTTCTCGAAATTGTCTCCGTAG
TTGTCACTCTTGACGTAGTTCAAAAACGCGTCGTTCGAGTCGAAGAGCTGGACCCACATATCTATGTTCTCGGCTAAGTAGTTGCGAGTGCAGGCGCTGT
ATGGAGCGATACAAATCTGGTACAGTACGACCTTCCCACCACATTCCGTCAGCACACTGAAGGGCGACGACGTATTACCGTCATGGTCGACTTGTGCAGT
GCAATTATAGGCAGATCAGTGTATACCCACACGATGATCAGGCCCGTTGGCTAGATGTTCCAGTGGAACTAGTACAAAATTTGTAGTACTATTTAGTAGT
GCTCTCAACGTACGAATGCACAAAACAAAAATAAAGTGGTCCACTTTATTTTTGTTTAATACTGGTACTGGTTTTGGGAAAGGTACAGATTTCGAGATTT
CTACTCACATATGGTACTGGTTTTGGGAAAAGCCCCTACTCCCTGTACATCTGACAAACCGCAAGTTTGCGTGTATTCCTTTTGCAAATTAATTACGTGT
AGACGGTTCGCTACGGGGACTTCAGTAATCATTTCAAGAGATTATTTTGCACGGCATCATGTGATAACAACATGGATTAGGCATGCAGATTAACCTTTCG
AGCTCTACTGCGAACCAAACACAAATACTTCGAGGTAGTGATAAGTATAATATCTGATACATGTACGTCCGAGTCGAGGTAGATTACTTGCAGATGCAGT
TCTTTGTTTGAATTGTCACTGCGACTGATCGCGAAGTAAAAGCGATACCGTAATTCGACAACCCAGATTTGGCGATTCCAAACTGCGACATCAGCAGCAA
AACGTCCAGATGAAACTTTTTAGGATGGGACTTGGCACTGGGTGAGATTGGCTCTTTGCCATGTCCAGGTTCATTCTGCAATCCACCCTCTCAACCCCAA
GTTCGACCACTGCAGCGATGAAGTTCCTGCTACCAGCCGCCATCGCCCTTGCTGCAGCGACTGCCCACGCGGAGGATTTCTGTGGTAGTACCGACAAAGA
GAACGGCAAAGTTGAAGTCGGAGCGTACAAGATCGTAAACAACAACTGGGCCGTTGCCGGCAAGCAATGCACGGGTGTGGATTGGAGTGAAACCACGACT
ATCGCCTGGCACACGAGCTACAACATTACCGGTGACCAGAGGTCGGAAATAATAATTGCGATTCAATAAATTATTGGGTTTTGCAATATAAATATGTATT
ATTGGTAGTTGAGCTTATCAATACAATATGGTATTGGACCAGTTATTGACAATAAATATGGCAAAGGCTCCCTGGTAGGAACCGTTTAATTGTTTCGATA
TGACATCACCAATCAGATCTTATGACATCATTTTCGTTGTTCACCACACTATCTCCACACCAACCTGAAACCGGTGGCTACGAGAGTGTCTTGGTAAGCT
ACGATACGCGAGCCACAACTCAAACTTCACTTCATTTTTGAACTACGATGGTCCTAAACAAGCAAATCGCCGCCTACTTCTTCACAATACTAGGTCAAGG
GCTGTTTCGCTGCAATATTTGCGGCAACAAGCGGAAACAAACTGGAGGGTCAACTAATACTTAGCACAAATTATTAGTTGCTACATCGTTCCGATGAAGT
ACTTAGAAACAAATATTCTAACAAGATGCTCAGTCAAGAAAACTATTCTTGACTCGCTTTCTTGTCGAGAATAATCAATACATTTCATTAAGTGTTGTGT
CGTCCTCTAGATAAGAATTGTAGGTCCAGCCGCTGCCTGGTATAGTGCACTTGTGAAGCAGCAGCTACATTTCCAGACTTCCCGGCTACGTAATAGCAAA
CGAAACAAGCAACTCCTCGCACTTGCTAACGTGAAGATGAAACATACAAGTCTACCTGACAGCCTGGAGCAAAGTTTGCAGGAACTAAAGAAGGAAGCAG
CTGAATTGCCCTGGTGCCGGCCTTCCTTGGAGGCTCTCCAGAATAACACGGACTCAGAAGATGAAACTTCAAAATTTGAAGATGGCCCCGCCTTATATGT
TGCTGATAGTATATACGCTTCGAAAACTAGTCAAGACGGGCAAGACTACTTTTTAGTTTCTTGGGTGGGGTTTCAAGAACTAACCTGGCAGCCGTCGTCA
GACCTACCACAGAACATGATAGCGACTATTAATGATGAGGAGCTTGGTGGCCAGTCGACTATCGGGTCAGCATACGCACGGGGATCATGGCTGGTGCAAG
AGTACAATACATAGCTAGATATTGCTCCAATATATTTAAATT