Description :
From Genome Similarity Track
Location :
Scaffold_3368:966- 2564
Sequence
1598 bases(100 bases per row)
TCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGG
GACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCAAACTACG
AATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCG
AGGACAGGAAGCCCCTGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAG
CCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGATCCAGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGG
GCACCCTGCAGCGGCACTTTGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACGTGG
AGCACGAGACGTGGAAATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTA
GCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACCCGAAGGAGTTCACGGGCAAGGATCAAGATG
AGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCTGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGC
GGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGA
GTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGTTGGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGT
TGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGCT
ACGACTTCCCGACGCAGACGAGCTTGAAGAAGTACTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGGTCCGGCAAGTATCGC
CAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAGTCAGGATCCGACGGCTCGGACTCCGACC
CTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTTTCGACCGGGGGATACCGTACCCGGGGACCGTGG
GATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGATTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACAT