Description :
From Genome Similarity Track
Location :
Scaffold_85:96597- 104725
Transcript NameFunction/comments
Physo_140397reverse transcriptase
Physo_140398hypothetical protein

Sequence
8128 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAATGCTACATACATTTACGACCATACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTT
AGCTAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCCAGTTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAA
ACAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAA
GCTAAGCTACGCTTCCTCATACACGTGCGGACACGTGTAAGCGAAAGTAGTGAGCCAAAGTAGGCCCACTACACCTGGTAGCACTTTGTAGTCCGTCCAA
CGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAA
CTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCCCTCAAACAACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGAT
GCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAATGCGATGTTGCTGCTACTACCGCGGTGTCGTCCGGG
ACGACACCACGCGCGCAATCGCTGAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCTTCCGTTGGCTTGTCGAGCTCGACACAGCCA
TCGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGCACGCAAGAAGTTGGGCGTATGAACGCCGACTCTCG
GATCCTACGTGCTTTAGCACGTACGAGAGTTTCGAGGATGAGCTCAGACGAGCGTTTGAGCCACCACAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCG
GCCTGCAGCAGGGCAAGCATGATGTCCATGTTTACGCTCAGAGAGCACGGTACTTGGTCTCGAGCATCGTGACCAATCCGATCGATGAGGCGACCAAGGT
CGTCACGTTCATGAAGGGACTGAGAGATGAGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTTTCGAAGCTGCAATTACTCTTGCAATGCAG
GAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGAAGGCCCAGAACCCATGGACCTCT
CGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCC
CGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGAGCACCGTCGCAGCCAAACAAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGTCCTACTGGTAAT
GCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCCAGTGAGATTCATTCTCACTGCAAGAACCAAGATGACAAACCTGACCTT
GTCATCCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGACTGCGAAGTCTATCAAGGCTTGACTTC
GAGGATTTAAAGATACCTCGAAGTATATTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAACGCATGGTACGCGTGCGCTTCACGTATG
AAGATCAAGAATTTGTCGAGACCTTTATCGTCCTGTATCTGGACGATAAGTTTGACATTGTATTGGGTATGCCGTAGCTTGCACGTCATGATCCGGTCAT
CGATTGGGAGAAGCGCACTCTCGTGTGCTTCGGTCGCGACAGTGGAACAGTGAGCGATGGACCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGAC
TCCCCACTCGAGACAGCGCCTATTGCCGCTGTCCCGGAGCACCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCACCTAGCGTCGGCGTTACCGCCGACAG
CTAATGACGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTC
ACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGTTCAGGTCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGAT
GGCTTGGGTGAATTTGATTCGTCGGCTCCGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCCGCCAATGGTTGGCGTCGAGGTACTAAAGTCGCGACGG
TTCCGGGAACCGGCGCTGCGAAAAGAAGTTTCGCGTCGACTCCCGGAGTCGACGCACCCTTTGTAACAAAGGACTCCGCCAATAACAGGCGTGGAGGTGA
AGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCTCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTT
GAAGTCGCTCGCCCGCGGGATAAACCCGCCGGCGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGACCCAAGCGGAGCCGGGC
TCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCACTGGGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGAAATGTCTACCGGGCAGACGGAGGCTGA
GAAGCTGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAATCCTCCGACGCAAGCGTCGGAG
TTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACAATGGACGCATCGAGTAAATATGCATTCTCTCGGACGCCGAGAGAACGA
AGAGCGAGAATGAAGAACTGAGGCAGTTCCTCATGGAGACCACCACTGAGAGTGAGGACACCCTCAGTGCGAAGACTAAGAAGGAGCGCTTTAAAGAGCA
GAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGAGGTCTTACGGGAGTACGCGGACGTACTTCCAGAAGAGATCCGGACGTACTTCCAGAAGAGATCC
CTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTACCGGGCACGAAGTACTGTGTCACACTGCAGTGGCCACTGCCGCGAGAGCA
GGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAG
CCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATAGTGCTCCTGATCTGAGCGATGGGTT
CTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCAAGCGGCATGCTCTGGGAGTAGCTAGTGATGCCTCAGGGTCTGAAG
AACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCTCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCTGGG
CTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTG
CATCTTCGGGGCGAGCGAGATACTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGACCGACGCCGTCGAA
CGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGTTACGCCCGCTGTCACAGCTCCTGAAG
AAGGACGCCGAGTGGGTTTGGACTTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAA
GATCGCCCGTTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACC
AATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTTCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACT
CGGAAGCAAACCGTTCGTCGTCTATACAGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTC
TTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCG
ACGTCAATGCCATTGACGCCATGCGATCGAGCACCCGAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTT
GCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTA
CTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGATCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTG
CGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGTAAGAACGTCCATGCTTGCGA
GGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGAGTGCTGGCAGTCCATGTCTTTGGACTTCGTG
TTCGGTCATCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCAGTACCCGCTGAAGTGA
CTGCGAAGCAGACGGTGCGTCTGTTCGTTGACATGGTGTTCAGCCACCATGGCATGCCGATCGACATTGTGTCGGATCGGGACCCGCGCTTCACTGCACA
CCTTTGACAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCTCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTG
CTCGTAGACGTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCACCATCAACGACTCGGTGCATGCCTCGACCGGGCATACA
CCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGAGGAGGATCTACGACTGCAACGCAGC
AGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAACAAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGACAAGAG
CAAGAAGAAGAAGGAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGC
TCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACA
ACGTTGGCAGGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAG
CAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACC
TTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCGCCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGC
GTGAACGCGCTGGGCCAAGCGCACGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTGAGCAACTTGAGCTCTCAGGGTCGCC
ATCTCCTGCTTCAGAGCGGCGAACTCACGGCTCTGAAGCTGCTCCACAGTAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCAT
ACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGATGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAA
CGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGA
AATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTT
CCTCACGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAATTGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACC
CGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGAAATACCAGCGTCCACAGAAGATCTGTGGAGCTGCTCCAACCTCCCGCGCGTCGAG
AATGTCTCGAAGCGTTCACGGGCGTGCTTAACCCGCTCACAGTAAGCAGCCAGCTTCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTG
CCTGCCACTCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGCTCGTGAAAGAGTCCGATATAGTAATCGCGCCTTTGATTCGT
TAACGGATCAAAGTGCTGCTCCTCCGCCACAGCATCATCGTGGATCCCGCTGCATACGTACAGCGGAATTTCATTTGGAGGCACAGTGTTGCCCACACGG
TCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAAATTGAAGACGCCACCTCACGCGGGGAGCTTAAAGCCC
CAGCAGCGGAGAGCGGAGTTTCGCTCTCGCCGCGCGACCGCTTCGAGCTTGAAGCGTCCGAATCGTCTCCTTCACGAGGGCGTCTCGACCCCGCATGCGG
GTCGAGACTATCACTGTCGATAGACTCCTTGCGCTTGTTGGAAGAGGCCTCGCCATCTTCCATCTCTACGTCGTCACTCCCGTAGTCAACGGCGTCGTTG
ACTACAGAGGAACCTTTGAGGACAATCTCCGACTGGGTTGTCCCCGACGCGGCCTTTGCAGCGAGCGCGTCGCGCTTTGCCTGCTGGCGCTCATGGTACT
GAGCAACAGAGAGGTTACCCTCTGTTGCGGCGGCGGTCTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAAT
TGACGAATGGTCAATTTCCTGATTGACGTGCCGTGACTCGGCGCGTCTAACCTTGAGGGGGGGATGGTGTAACGGGGTTACACGCACAAGTGGCTACAGT
CACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCA
CGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCT
GTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTTGATC
GTTTATTTAGATTAATCTACACTCGGAGGCCCGAGTATAATTAACTCTAATTTAAACTAAGCTACGTTTCCTCACATACACGCGCACACGTGTAAGCGAA
AGTAGTGAGCCAAAGTAGGCCCACTACA