Description :
From Genome Similarity Track
Location :
Scaffold_161:9658- 16657
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_161-abinit-gene-0.27Adenylate kinase domain-containing protein 1
Pytve_DAOMBR484maker-pve_contig_161-snap-gene-0.21Protein kinase

Sequence
6999 bases(100 bases per row)
AGCGCGAGGAAGACGCACGCCGACGCAGCCAGTGGCACATTCGGGAACTTGGGACGCGCACTACCCAGCGCCAGTAGAGCCGTCTGCAGTTCGGCGCTCA
GCTCCTGCTCGAGTCGGCCGGGGTAGTTGCGAGCAAGCGCGGCGGTGACCTGAGGAGGCAGCTTCACGGGCAGCTTCAGCCGCGCAAACTGCGCAGGATC
TGCGAGGAACGCGCATCTTGCTGATTCGGAGGCGAACACGAACACGCGCCGCTCGTAGCTGGCGCGGAAGAAGACGCTCCCCTTGACTAGCGCTCCCCAG
TCCGCAGGGCCTTGACCCCGCGCGAACGTCACTGGACAGTAGCCGCGCAGCTCGGGGTAGTCGCAATCGCTGACCGTGATGAGGCTCAATATTGACGCTT
CCACCGGCATTCGTTCGCGGGTCTGACGGGCTTTGTCCGCAACCTCTGCTGCGAGATACGCCGGCGGATCGGCTATGAAGACCTCGAGGTTGGCTCGACT
CGAGAGCCAGAACGTGTGGTCGCCAAAGTCGACACAGAGCGAGCGGTCGTTGGCGTGTGCAGCCACAGCATACCGCCCAGCACTCAGCTCGACGGGACAG
AACGTCTCGAAACTCGGATGTTGACGCGCGACAAGACTTCGGAACGTGCGGGGCACGTCGGATGCCTCGGCCGCCAGCCCGGCGACTTGCCGCTGGCGNN
NNNNNNNNNNNGTACCGCCGAAGACTCGAGAGGTGGCGTGCCACGACTTGCTGGGCTAATGCTGATAGCCTCCACAAACTCGAGGCGTCGGCATCGAGCT
TCGTCACGAGAGCATCGCCATATGAAGCCGTCCATTGTGAGAGCAGCTCGAGGCGGCGGCGCTCCCAGGTCGCAAACGCCGCAACAAGTCCCTCCCGGTC
GATCAGCGTGTCGATTAATGGCGTTGAGTGGGCTTGCCGTCGACCCCACGTTGCTTGAAAGCTCGCATCAAGTACGATCAGCATCCCTGGTTCCACGTGG
ACACTTTCGCTGGGAACGTGTTCATCCGGAAACAGCACGAAATCCTCGAGTATCCAGCCACGAGCTTGGCACTCGGCTGACTGCAACCGCGCGAACACTG
CAGCACGGGACGTGGCAACATCCGGCGAGGCGTCGGCTGCGTCCATTGGCTTCAATGACGACCAAAGAGCGGAGCCTCCGAGGCAGCTGCGCACCCAGGA
AAGCGCCGACGTCGGCGACACCACCACTGCACCTGTCGCGCGCGCGAGCTCAAGGGCCAAGCGTGCAGCTGGCGTCTCTGGGGAGCCGACAACGCAACAC
GCTAGCGCCACGGGCGGAGGAACGCTCTGTGTCTCGTACACGAACTGCCAAGGTCGAGCAGCAAACTCGGCGGCAGCCGCAGCTGTTGAAGGAAAATAGA
CGCGGCTCCGATAGACAACCGCGTGCTTGCCGTCGCTGTCGCGACCGCCACTTCCGGTCACTGGACAGTTTGCATCGTGTCGACCAATCTTCAGCTCGCC
TGACCGGAGCAAAGCGCGCAGGCGACCCGAGCTCACATCCACTGGCTCGCACCGTTCGAACAGAGAGTCTCGGTGCGACATCAAAACTGCGAGTGCTGCA
GCCACATTCTTGACTCGCTGACGCTCAGATCCATCGGCGTTCACAGGCGCAGCGATTGCAACGCCTCGCGAGCGGAGAAGCTCCAATGCGGCCGAGTTTG
CCTCGTCGTCGGCTCGATACAGATCCCCGAGTCGCTGCTCCTCCTCGGCTCGCGCTGCAGCTTCGTCTTCTTCCTCTTGCTCCTCAGGTTCCTCTTGGTC
TCCGTCTCGAGCTGGCCGTTTTCGTGCTTTCATGGCCTTCGCCTTCTCCTGGGCCGCGAGCCATGGTTTCAGTCGACGTGTCACAACGACTTGTTCCGAG
ACCTCGAGCGGGATCACGAGCGTCGGGAAGATTCCACGAGCGAAACACGCGGTGAGAACCTCTGCGGTCGGCGCCACCACGTCGTCTGCTTCCCCTCCAG
GCCCTGATGCGCCAAACCAGACAACGGCAGGTGGAGCTCCACCATTCCAACGCTGATCAACGTTGGCAAGTTGGTCACGGAGAGCATCGGCCATCATCGC
CGCCTCGTCTGGCGCTGAGTCATCTTGGCCACGCTGTAGCGACGCCAACTTGCGTCGCCGAGCGATCCCGCGTTTCATCTCCCCCAGGTCGACAGCCACC
GTCCTCGACTGGCTATCAGCTACCAGCGCTCGACTGATGATGCGGCGTCCGGTTCCTCTAATGCCAAGCAGCAGTACGAGCGGGACGAGTCTCGTGGTGG
CACGTGGCGATTGTGGGATGAACTTGGTCGGGTCGCGAGTGAACGCACGGAGTTCCTGGTCGCCCGCAAAAGCGTACAGCTGCTGCTTGACGCTGGACAC
GAAGGCAACGCGGCCAGGCACTAATGTGTGATGGGTGGCCCATGACACAGCACAGTATCGCCCGGTCTCACCCAATAGCCACGATGCATCGGCATGGCCG
TCGCCTAGCCACGCACTGTCCGGAGTATCGCTGTCGGTGGAGGCTGCGATCTGCGGTGGAGCGTGACCATCTTTGTGGTTGTCAACACGAAGAGCGAAAG
GATCGAGCGCTGAGCGGACAGCTGCCACGACTGCTTCGTCGCCGCCAGTCAACGAGACATTGACGCGATGGAGCTTGACACCGAGCGGCGTCAACAGCTC
CTCTGCAGCACCAAGCTGTGCTGTGAACACCTCGACACGTTTGGCGGCAAGATTGTCCCCCTCAGGAGGCTGGCTGTAGCCTTCGAGCGCCACGATAACT
TCAGGGAGGCTTGTGTTTGACTCGAGCACATTGAGAACCTCGGACGAGAGTGGCAGGTCCGCCAACAACCAGGAGGATCCAGCACTCAAACCTCCGCTGA
CGAACAGACTCGCCGTGGCGTCGGCAGCCGATATTACACCGCCCCTCGCTAGCGCTGACCGATGATTATCACCGGTAAGTAGTTTCATCGGCGATACCAC
CGGGAGACCGAGCGCTTCGGAGATTGTCGAAGAGATCTTGAGATCGTTTGGTAGTTTCGGGCTTAGCAGCCAAACGCGCGTCACTGGCGGGGCTTGTGGC
TTGCGGCGCAGGTACTGAAGCGGGTGAGCGATGAAGATGGAGCGTGCTGCCGCCGACGCCAGCAGATAAACGCGACCAGCCATGACGGCAGCGAAAGCCG
GGCTACCGAGTTCAAGTCGCACACCGAGGTCCGAGGTCACAGGGCAAAACTCACGCCAACGTGAGAGCCGTCTGTGCGAGGCATGGCGTCTAGGGAGGCG
AGCAAAGGAGTCGACTGAGTCGGCTTTGTCTTCAGCGGCCAGCAGACTCACCCAGTCCCCGAAAAGCAGCCAGCGAAGCTGCTCAGCGCGGGGAGCGGAC
GCCACCTCCTCGGGCAACGCGATGGGGACGGCGGCGTGTGAGTATACAGTGCGCGACACGCCTAGTGAGGTCTGCGCATCGAACAACATTCCATTAGATC
AATGTTGAAAAAAGTGATGCGAAAAAACACCGGTACGAACCCCGCACATGACTTCAACGCACTGGTTGACACTCGAGGCGAGAGCTTGGCCGGCGAGAAT
AGCTACCTCGTGCCATTTCGGTGGTGCTGACAGTGTCATTGTCTTGATGGACGCTCGCCACTCGCAATAGCCGTGGATGCGTGTGGCGAAGTACTCGATT
GTGAGCGACTGGAACGGCACGACAGGCTCCGCAAGCGGTGGGACGCCGTTCCTCTCAGCTGGGGTCGGTGGTGATAGCGGAGGAGGTGGGCGATCTTGTC
CTTCGTCCTCGGTTGATGTCAGTTCGGCAGTATCGCCTTCGCTGTCGTCGGGGATGCGGGGACTCGTGACCACCTCAGCCGGTTTGTTTTCTCCGGCTTG
GTTGTCTGTTTGAGGTTCAGCGTCAGCGAAACCCACCGCTGCAAGCTGTTTGAGAGAAGACGATGCTTTTGCCATCGCCAGATCACGCGAGGAGTACACG
ATCCGACCGGCAGGTGCAATCATGAGCCCTGCAGCTCGTTCTGCCAAATCGGTCTTCGGCGCACGCAGCGCAACGACAAAGTCGACGCCAACGGCCGATG
CCAACTCCGCTGGATGGACGTCGTCCAGCACGACGCCAACGCCCTCTGCTCATCAACATTGTCAATATCCGAGGCAAACATCAGCAGTGCATTGGACACA
GAAGCATACCGAGGAGCGAGGCGGTCGCGACATGGATGAGAAGAGTGAGCGAGGTCGTCCTTGAGAGCGTGAGTCCCGAACGAAGTCGAAGGACGTCGCC
TTCGTTCAGGAGTGCCGCGAGTGGCTCGTCCTCATCTGGAGCCGCTGGAGCAGGCTCTGGAATTGTCTCCACTTGGTCTCCCACTGGTGGTTCGGCCGCT
TCCTCTGTTGCCTCAGTGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCTCAGCAGCAGCCGCCTTAGCCGCCGCGGCCTCAGCGGCAGCAGCAGCAG
CAATATCCTGACGCTCTTTCCGTCGTCGAAACGCCGCCAACGCGAGTTGGATGGCCACCGGGAGTGACAAGTACCGCAGACCGAGCCGCGCTGCCAGGAG
TTTGGCGAGTCGCGTCTTGCCGCTCAGCGGCGGTCCNNNNNNNNNNGCCGCGCCGGGAACTTCTCGAGCGACGCTATGAACGCGAACTCCGAGTCCCACG
AGTCCTCACTCTGGACGTTGAGAATCGCAGGCGAGGACGATGGGATGGTTCGCTGCTCGTCGTCGATGTCCAGCTCGTCCTTGGCGCTGTCCGTATCGTC
CAGTGGCGGCAACACTGCTGCTTGNNNNNNNNNNTCGGTCACCGAGGCGAGCGTCGCCATGGCTCGCGACAGTGCGAGCTTGCGTGGGTTGTAGGCCAGC
AGCAACTGCTTGAGCGACATGGCGCGTGCGTCCGGCGGTGCGAGGCCGCTCACATTGGCGAGCTGGTCGTGTCCTGGCGGATCAGACTGGAGAAATGCAC
CGCGGATCTTCTTGACCGCCTTGAGCGGCCGCAGCACATACCGCACGGCCTCGAAGACTTGCGGCACGGACAATGATGCTTCGAGCGTCAAGTCCGGGCT
TGAAACCTGCTGATCCCGCTCGAGGTCGCCGAGCGAGGCGAGGTCCTTTGGCTCGGCGATCGATTCGCGCAGCTCGAGGAAGAAGGACGCGATCATGGAC
GAGTCGCTCTCGACGGGCAACACCAGCTCCGCCACCTCCATCAGCGCCTCGCGGAACAGCTCCATGGTCAAGCACGCGCAGCCGTCTGCGCCGTCCACGG
GTCGTCGACAGCTCTCGCCGTGGCTGTCGTAGAGCCAGTCGCGCGCCGCGACCTTGGCGGCCTCGCTGGCGTTGACGGACCGCACGAGCGCCGTGGCCGC
GCAGGCGAAGAACGCGACGTACTCGCTTCGCGAGAGCACATTGCGGTTCGCGGGCGTGGCCAGCGACCAGAAGAAGCCCAGATGTCTCGCCACGGCGTCG
GTGGCCGCCAGCGCCTCGCGACGAACCAGCCACGCGCGCAGCAGACTCGTCGAGCTGGAGGCGGAGGCCGGCGTGTCGCCCACGCTCGGCTCGCGCTTGT
CCTCACCCGGGAAGACAAAGTGCCGCCGCATGTCGTGGCGCGGATGCCGAATGGCCAAAGCTCACGGACACGGGCGGCGGTTGCCACCGCAGTCGGCGAC
CAGTCACCGCGAGGGTGAGTGAGTGAGTGTATCAATAGGGGCAGAGTCTTCAAGTTGAAGTGGATTTGAATTGGAATGGCTAGTATACTTTTGTTCATAT
TAATAGGGAAAGCGCATCATCAAATGCGCAGCCACCGCTCAGGCGACGGCGGTGGCGGCGCGGTCGCAGTCCCTGGCCGCGGCGGACGGCCGAGCGATGG
CCACCCGCGTGTCCACGAGAGCGATCTCGGCGCTGTGGGTTCGGACGCGGCCGGCTTTCTCGACGTGGGCCGTCGTGTGACGGTCATTGCGCTTGGCGAC
CTGCTGAGCAGTCTCCAGCCTGTGCACGGGGAGCGAGCGCCGCCGCGTGGACAGCGTCTTGGGGATGGCGAGGCGGTTCGTCGGGCGGCCGGAAATCGGC
TCGAGCGTCCGTGCGGCCGCCACCTGGCGAGNNNNNNNNNNNNNNNNNNNNNNGTCCGACAGCCACGGGTGACGCAGTGCCGCCGTGACCGACATCCGCG
TGGTCGGGTTCACGTCCAGCAGGCGGCTGAGCAGGTCCACGAGCCCCGCGGGAGCGTCCACGAGCAGCTCTACCGGCGACGACTGCAGCACGCGGCGCGC
GCCGTGGGCCGCCAGCTCGCGGAAGACGGCGTCCTGGTCCGTGGCGATCCCGACGAGCGGCCGCTTGGCGCACAGCGCGTAGAGGATGACGCCGAGAGCC
CACGCGTCCACCTTGAGCAGGTCAATGTCCCCCACGTCGGCATGCATCTCGGGAGCAGCAAACGCCTGCTTGGCGATCGACACGTCGCGGACGTCCACTG
TCTTGTTGTGGACGCGCACGGCGTGGCCGAGGTCCGCGACTTTGACGACGCCGCTGTCGGTGAGCAGCACGTTCTCGAGCGACAAGTCCATGTGCGCGAT
CCCGGCGCTGTGCAGCTCGGCAACGCCGCGCACGGCCTGTCGGAAGAGCGTGCGCACGCCGGCGGCGCAGGTCGTGAGTCCTTCCTTGGCCGACAGCAAT
CCAGCCTGGGTCATGCGCTGCTCGCGTCGCACGAGTCGCCAGAGATCGCCGCGCGCACAGAACTCCTGCAGCAGGTGCAGCCGCTCGCCGACGAGCGCGT
AGCCCTCGAGGCGCACCACGTGGGTCTGCGCGCCGAGCGCGAGCATCAGGTCGAGCTCGCGAAAGGCCGAAGCCGCGCGGACCCTCCCTGGACCGCGCGG
GTCGGCCACGTGCACGTGCTTGTCCACGAGCATGCGCCGCGAGGCCGCGCACTCGACCACGTCCACGCACTGCGCGCCGCCGTCGCGCTCGTGCAGCCG