Description :
From Genome Similarity Track
Location :
Scaffold_419:96557- 97882
Transcript NameFunction/comments
Aphin_H310_00862TATA-box-binding protein, putative
Aphin_H310_00863NHL repeat containing protein

Sequence
1325 bases(100 bases per row)
TTTGTCGCCGAAAAGCGAACGGGAGTTGTAATTCGGTTGCGCACCTGTTATCCGGATACTCCGTCGAGACCTCAAGGGTCACCATATTTGGATCCAGTTG
ACGATCGATATGCGGCACACGCTGCTGGTAGCAGCATGCGGCATTGCGACATCCATGCGTGTCCACCGCGCGTGGACGACACAGCCGTGGTGCGACAGCG
TTGTGTCGCCAGTGTGGCCCTTTGCGTACCAGAAAGACTCGGCGCAAACCGTGGAATTCGCCGGTCGCGTCAACACTAATACTCAAGACATGCGCCACGA
GTGCTCGACTTATGGCGTCCAAAGCAAGTGCCACATGTGCCAAGACAATTCGTTTCAGATTCAAGGCGTGGACTGGGCAGCCCTGCCCGTCAACATTCCC
ACCGTCACGGACAGTCCTTTTGTTGTGTCGATCGATGTCCCCACCCATCGCTACGACTATGGCCACCCCAACATCAGCCATGTCTGCGTCCTGCTCACTG
GTGCCGATTGCATTACCCCACATGCCGCAAGCTACGCTTCATGCACGACGCGGTGCTGGGGATACCACGCAGGACCACTCGGACGGCAGGCAGACGTAGA
CAACGCGACCGACGTTTGGTCATGTTCCAGTCAACCGTCCAAGGCCCAAGGCCAGGTGTCGACCGTCGCAGGTTCTGGTCAGCATGGTTTTCAGGTATGA
CATTATCTCCGTGACAAGTCGCAAGTTTACCACATTCATGCGATGATGGAGAAGGACGGGCCCGTCGCGACCGCAAAGTTCTCGTCTCCAAGAGGAGTTG
CTGTGGACAGCCAGATGAATGTTTATGTGGCCGACACTTCCAACCATCGTATCCGCATGGTACAACACGCTCGTTCGATTCCATTCAACGCCTGACGAGA
CTGCTCGGGGTAGGTCCGTCGCGCAAGTCAAGACGTGATCACGATTGCCGGCGACGGCGAGCGTGGAACTCGGGATGGAGCCGTGGGATCTGCTCGCTTT
TCGTTTCCCACGGGCATTGCGGTGCTGGAGTCGAATGGCGCTGTTGTCAAGATATTCGTTGCCGACACGGGCAACCATCGCATTCGCGAGATCAACTTGC
AAACGCAACGAGTGTCTTGCTTGGGAGGCCGGTGCGGGAATGGCACCGAGACCGCAACGTTAGCCCAGGTGACGAACTTGCCCAAATGCAGAATGACGTG
AGTTGTCCATTGGGGCGGTGTAGGCCGTTGCTCCCCCGCAACCAGGACTGGCCGACGGGAGCCCCAACAACTCTACGTTTGACAGTCCCATGGGCATAGC
TGTGACGCCCCAAGGCGTGGTCTTT