Description :
From Genome Similarity Track
Location :
Scaffold_20:96554- 98129
Sequence
1575 bases(100 bases per row)
GTTCGATGCTGCCAGCTGACCATTGGCTCGTACCTGCTGAGCCAGGGTAACCCTAGGATGACATCAGATTTGTCATCCAAATCAAGTACGATGAAATCAT
CATTTTACTGCAAATCTTCTAACGTGTAGTGAAATCCCACTGCACATTTCATCACTGCTATAGATGCGCCTGTTGCGAGGCGCACCGGGAGTAACGCGCT
CAATGAACTTGAGCCTACGATCCTCTAGCGACTGGCGACGAACAAAGTTGTTCGACGCCCCCAGTCAACTAAGGCACGAAGTGACAAATCTTTTGTCACT
TCTAAATTCAAGGTGAGGAGGGGTACCTCATCATCAAGTGCAGAGACGCACAAGGATTGTGAGTCTGGAGCAACTTTCATCAATAGATATGCAAATTCTA
TTGAGGTTGCTGGATCAGTAGGGCGCTCCGACCCTACTGACCCCGACCGTTTTTTTGACGGTCCGCTACGCTGTTGTGACTTTGCAACAGCGTCGGACTC
GGGTCCGTTGTGCTTCTTGGCAGACGGTCGATCACTTCGCTCAGTGTTACGAGACACTGGGCTTGAAGCACTACACTCGTAGGCATAGTGACCTAACTTC
TGACAGCGATTGCACTTTTGCAATCGCTTACTGCTTAAAGAGCAAAGTCTCTCGCTATCTACACTGCAGAGGTCCAGTGGTTCTGGACCTTCCGCCTCTA
CTCGTCTCGAAGAACGATAGGGGGTCAAGCTAGTGTGAACCTGTCTCACCCTCAAGTCCTCTTGCACCGCAGTTGTAATCTCTTCCTCAAGCGACTTCAA
CTCGATGCGGAATAGGTTGTTCCTCACTGGACCATCCATAAGACTCTGTAAGATTATCGTGATCAACACGAATTCACTTACAGGGTTAGCTACCATGCAA
CTTGCAAGGTAACGAACGTGCTGAGCGTAAGCGTGAACGTCACGCTTACCTTGTTTTATCTCCAGGAGCTCTGAAAGAGTCCTGAACTTATCTCTTGGCG
GCTCAAACGTTTGGATCGTGTAATTGAAGATTCAGGGCCCAAGTTCTGGAACGCCCTGAAAAATTCGATTTGGCAAATGCAACTTGCATTTCCTCATCGT
CGATGTGGCGAGCCTTAATGGCATCGTTCACTTCGAGGAACCATCTCAACAGGGATTCTTCCTCGACTCCCCGGTACTTGGAGCTTTCTAACTTTAGAGT
CTCACGTTGACGCTCACGTGTCGACGCTGCAGTAGCAGACTGAGACTGTTGCTGTCTCAGGAGCTCAGTCTACTGGTGACCGTGCTGATGCAGTAGGGTC
ACTTCAGCTCGCGAAGCGTCAAGTTCTCGTTGCAAGAACTTGGCGATTATCGAATGCTGTTGGTCCCTATCCCTTGAGAATAGCAGAGACTAGACAGCTT
CTTCGCCAACGGTCGAGCTCATTCGTTCGACCGCATTCCATTCGACATCACTCAAGTAGGAGTAACCTTCACGGTTGCCGTGAAAGATGTCTTTGCCTTA
GTCGTCCAACATGTTCATGTTGAACGGGTTTTGTGGTCCTTGGACGGACTATAAAGTGTTACCAGGTGTAACGGG