Description :
From Genome Similarity Track
Location :
Scaffold_221:9655- 30861
Transcript NameFunction/comments
Phyke_g6834hypothetical protein

Sequence
21206 bases(100 bases per row)
CCTCGAGGTGGCACAGTCTTCTTGTTCGCCAAGTTCTTGAGAGCCTGTCGCGCAGACGAAGGGTCCTTCGATAGTGAACTGCTAGATGTTGCAAGTGACT
CTGCAACCCGGGCGGTTGAATTGACATTCTCACCGTCCACTTCcgctccttcttgaccttgacGCTCTAATCGTAGCCGCTCCTTGTGGTTCTTCTTTAG
CGTAGACTCGAGAGCGAACTTTTTGGGCGAGAGTTTCCGATTCTGCCAAAACACATACGTGCCAGTAGGTTGTGCTGGCACATCGTTCGTTGCGGTCGGC
GCTGTCAAGTTGTCGGTTGGTGGCAGGCCGCCCCTAGCTTCGTCGATTGCTGTTGGCGGTCTTGTGTTTTTGCCTCGATGCAGTAGAGATGGCAGCCGTC
CACCCACTTTGCGCATTAATTTGTGAGCTAGCGATTCACGCCGGTCTCGTAACTCACGTAGCATATTTTGACGCTTCACCAGCAGTTCAGCGCGTGGATC
AGCGCTAGGGCCGAATCTGTCGGACGAGCTCACGAGTTTCTCAGAGTCGATTCTCTGTCGTGTATTTGAAGGTTGATCCGAGTTTATGGCTTGCGATTGT
AATGTTTGGTGATAATGACGCACGCAATGCATACCATACAGGAAGTGCTCAAAGTCCACGAGATCTGCATACGCTGGATCAAAggcttcaagcagctccc
TGACTGTCGGTGCTGGTACATGAACGCCCAACTCATATACTGCCTGCGCGATGGCTGTATGCGAGACTAAGCCGAGCTGTGCTGCATCCGCAGATACAAA
CAGCAATCGGAaggcttcaacttcttcgtcgctaAAATTGCTCAGCGTCTTACGAAGTGTCTCGCGCCTCTGAGCCTCTAATGTTCGGTGCAACTTCTGC
TTGTGGGCGCGTAGTTGCCGCAGGTAGCGTGCGCGTGTTACCCGCGTGATCAATCGGTGCTGGATGCGCACGGCTGCTGCATATCGCAGACGATCATATA
AGTTGAGTGACTTGGCCAGGTGTTCGTGCTCCAACGATCGCGCATTCTGTGGGTCAATACGCAGCGCAGTCCGGCCATACCGAATAAGTCTTGCGATTAG
CGTACGGGACCACCAATCCTTCACAGTTCGAGCCACAATGGACGCAAAGATGACGGTGGGTTCCACTACTAGCTCCTGCGTGGCCACGCCCACTGCCCAT
GCCAACACGCAACGCCATGACGTCGCCAAACCTAGTTCCATCGCACTAATCGCCACAACGTACGCCATGACCACAAGCCAAAGCAGACATATTGTGAACA
CTACATAGACTATCGATGCTGGATACGGAACATTTGTGGTGTCGTCGGCACCAACAGTGCTCACCCCGGCGGTGGTTTCTCCCTTTTGCCCCATGTCATG
GTTTCCGTCCAGAATATCGCCGTCTGCAAGGTTTTCGTGGGCTGAAGGAGTACTGGCGATCAAAACCTGCTCGTGCTTCAGCGGTGCAGCTGCGAGCTCA
CTTGCCACTGTGGGCGCCACGCTCTCTAAACTCGAGGCCAACAATTGTGAACGAAGCTTTCCACGAGTTGGTGCCGCAATTTTCAGCCCAACGACGGTCT
CAAACGTCTCTCGGATATCTCTTTTTACCTCTTCCGCATCGGCTGTAGGGTCTGGTACACGTAGCTTGAGCTTGGAGTCCTTAGAAATGGCTAATTCCCG
TGCCAAAAAGAACGCGCTGACGGCCATGAGAAAAAGAAGCCCTGCCATGGCAATTGCACAGTACGTAGCTACATCGGCACCTTGCTGGAATCGCGTAAGC
ATTTTGGAACGACAGCCTGGCAATGCAGTAAACTCCGCCTGCGTCTTATCCACGACGATGCCGCTGACACTCAGCGCTTGGTACGTGATTTGTACAGGAT
CTCCATCCGGGCACGGGAGATATGGAGCGTCTGTTGGGCCTAAGAACCCACAGCAGCGAAGTTCTTGTTGCACTGTGTTCTTGAAGTAGCCTGTGAGTTT
TTCTTTCCACGCAGTCTCAAGTCGTTCAGCTACGCTAAAACCTGTTATGCGCACGCTCCAGTTGGTTAGTGCGCTGGCATCCTCTTGGACGACCTCATGC
ATCATAAAGATCGTAAGCAGTACAGCCCCAAGTGCAAACAGAGCAGcaatagccaccaccaccaatgcCACAATTACAGGAGTAAGCTTCAGACGATGTG
ATCGTTTGAGCTGTTGCTCACGAAGATCGTTCGCCAGTGCTGCGATAAGAGCGACAATCACAAGCCCAAACGCAAGTCCAAGTAGCTCAGGAACATCCTC
GTCAAGCGGTACACCATAGAGCGAATTATTATAGCCAAGCCGAAGGAGACCGAGTAACGTAGCGAGCGCACAACCCCCAAAAAACAGTAGCACGCCACAC
ATCTGGAACGTTGCTGCCTCGAAGCGTGTGAGCCAAACAAACCAACGTTCCTCGGTCGTCGACTGCGTCGTATCAAGTGTGGAGGCTTCGTTAGTCAAAA
CTGACTGGTCCATGATCTGGGGTGACCCCTGAATATCTCCTTGGCGATGACGTCGAAACCACGGTTTGCGGAAaagcagcaccttctcctttCGCTGCCG
CGCCGTAGCCACTTCCTTCGTTTCATCATCTGCCCGATTGCGTATGTGCTCGAAGAGCATGATTGTAGTGGTTTGCACGGCAAGTCCGACTATGCCACCA
TATACCAACCCGAGGCCGAGTAATTCTCTTACTCCAGGCTGTTCACATGTCTTCAATGCCGTCCGGTAACACCCTTTTGTGGCAAAGTATCCCGCATATA
CCGCAAGCGACGCAGCCCAAGCACAAAGCAAGCTCACAGTACGCTGTGCCCGGGTGAGTCGTGCGTCAAAATGTGAGCCAATCGAAGCCAGAATGTGATA
CCGTCGGAAATCGCGTCGGAAGCTGCCTGTCACATAGCGCAGTTTGCTCTCGAGAACAAACCAGGCCTCACCTTCGTATCGGCGGACATCCCGTAAAACA
AATGCACCGAGCACGAGTATCACTGCCTCCATGATGGCCAACGAAATGAAAAGCGCAAAAAGCCACGCAAAAGAAGACTCCACACCCTTTACTAGAGGAG
CCTTGCAGCCGTGGGAAATCACAAGCGAACACTGGGGATACCCAAGCGCTGGACGGTCGAACACAACGCCTTTGCCCACTATCAGCACTGGATCATTAAA
TCCACAGCATGAGAACTCTAGCCCTATTTCGTGTTGTGCGGCTGGTCTAAGATCACTCCATTGATCATCTAAGAAGCTCGTGAGTTGTGCAAGCCAACTC
GCTTCCGAAGCGGATGAATAGTGTGAAAGGTGTGCTGTGAGTCCTACACCTGCAAGCAGCGCAACCAAAAGAACCAACCGCGCCAAGCATTGCAAAAAGA
GTTGGTGCACACTGAACTGGAATGCTGCTCGTACTGAGTACGCATGAGTGAGTAAAGCTAACACCCCATACAGAATCAGTACCGCGCCCACCGAACGCGC
AAACATCAATTGGAGTGCGCTGGAGCAAAACAGCGTCCAACCCGCAGCTACATCCAAGCCCAGGATCAGACATGCCAGTGCAGCCAGCGTTCCTAACAGC
ACAATGAAAAGTAATGCAGAGCGCATGATCCGAAGGCGCCAACGGGGATGCCAGTTCTTCTGCCTTTGATCGAAATCAACCAGACCGCTAACACAGAGCA
GTGTAATAACACTAAAGCCGGCCAGTCCTCCACATACTTGCCAAGCGATCCGAGACACTCGCGAGACGTAGCGTTTCATTGGGCTAGCACATCCATCGAT
GGCCTCTAAGGGACATCGTGCAGTGCTGTTCAAAACAGTCGCCTCGGCCTGAGTTTCCGTGAGAACACGCTTCTGAGACTCTGAGCCATTCCATGATTTA
TAGATGTCATATGTGGACGTCGAAATAAGCTGGCGCCACCCGAACTGTTCAGCTTGGAGTGTGTACGACACAGATCCATTCGCTGCGTCGATACGCTCGT
AGCCACAACATTGAAGCGAATTCTGTACAAATTGTTTAGTAGTTGACGGCGCTGAGCTCCATACATCCTTGAGGCGCGTGTCGACTATTATCGCGGTGAT
ATGAGTGGGGTCGTCAAAGGCCAGAGGGGATAACTGTGTGGAAAACTTGTGAGCTACTCCCAACACGCTGAAAGCACCCACGAAGAGAGCTACGCATGAC
CCTGCATAGCAAATTACTAGCCATTTCATCCTAGCTTTCATACATGGGCGTTGCAAAGTACTATGAGCACCCATCCACGCCACAATACCACCAAATCCTG
CGAATAACTCCATCGCACCGCCAAAAGCAAGTAAATAAATACCAAGCCGTCGATCGAACACGCGCAGCAAATATGAAATCTGCAGGATGTTGAGCTCTAA
GAGCACATCAATCCCCAGACCGACAATACCCAggcctgctgctgctgcgcccAAATTCAATAGAACTAGTCCAACGACGCACGCTTGTTGGGATAATGAA
GGTCGGCTATGCATTGCGTGGATTTCATGTTCAGATGTTGCGGAGTGAACTGCAGCCAAGCCCGAGAAGCGTCGTAGTCTAAAGCACATCCAAGTGGTTA
GTACAATCATGAGCGATTGAGCTACCGCAAACGCTGTGAGCCGGTCTGTCACCAAGGATAATGCTCGAATCAGTGCCTGCTCCACTTGTATGCGGCATGT
ACGTATAACGTTATTAGATGCGTCTTCGACACAGACCCCTTGGGTGCTGTCTCGGAAGCCGCAGCACCCCATagccatctccatctctaGCAATGTTGTC
GATCGTGGGAGTCCCACATACTTGGCTTCGATAGCTTGGCTGATAGACGGGTCTAGGTAGAAGTCCGTAAGCAATCGCTTCAAGTACCCATAAATCCCAA
TGGTGAAGAGTAAAAAGACCAACGAAAGCACGACAGTCCAACGGAGAGCCCTAACGTCACGCGCTCCTACTACGTGCAACACTCGTAGTGTAATAAGCAG
GTAGATCACGGCGCCTGAGACGACAAATCCACCAACCTCGACACCAAACAGTGCAGCGACCACCGGATCAGCGACAAGTCCCGAGCGTACGAATAAATCG
ACGCCAAAGAGTGCTGCACCCCCAGCACAACATGCAAGCACTGCATACAGCGGTGGTAGTGAACACAGGAGTGCAACTGATACCAGTGATCTCACAATAC
CTGCCTCAGCACTAGCGCTTGGGCCATTAGTCGCAAGCTGGAGCAAACGAATACGACGCCATCGGACGAGCAAATTGGCCAGAGCTACGCAAACAATCTC
CCCAACAAATACAGCTTGCATGTAGCCAAAGGAACTGGCGAACAGCTCTGACGCTTGCGAACCTAACACCATTGAACATGTGCGAGGAGGGACCGCGTCT
AGAGCTTCCTCTGGACACGACGTTTCTTCGTCGGTCGCCAGAAACCCACAACACCCATACGAATCCTGCAGTTGAGTTTTATCTCCCAAAGACAGCGCAT
CCCAATGAGACCGTAATGCGAGGGCCACGCCACGCGGCAAACTTTTAAAGTTTTCGACAGAGTGAAACATGAACGCCACTATTAGCAGCTGAGCGAGCAA
ACCGATGCCTAGTGACGCCAGGTAGACTGTACGACCCGCTTTAGAAGCTTCTCGTCGTGACAGATAGACACCAGCAATCCCCCCAGCGAGAAATACTGCG
CCGCTCACCATGAGAGCAATACCTAGTGGTCCACCATACAGATAAAGCACAATCTCTGCCGGGGTACGACCAAGAACGAATTGCACCTCTATTccagcaa
gcagcagaacaaTTCCCATCAGCGCCAGTAACAAGTTGCTAATTCTGAAAAGCATCGTCACACGCGCGTATTGCCGATCCACAAGGCTGGAGGATCCGAA
CAGAGTGCGTGCCTCATCGGGTAGTTGCACGGTTGGGTCCAGTGGCTCTGTCGGAGGTGCTATGAAGGAGCGGTTGAACATGCGCGATTCGCTTGAAGAG
GAGTCTCCGGCATCTGTTGTTATTGCCGTTTGTGCCTCCGAAGGGTGTGACTCTAGTCTTTTTCTCTTCTGCGCTACATAGTAGGTGTCAAAGTCCTCAA
ACACGTTGCTAGTTTTTGTGCGTGCTTGAAGTTCGCTCCACTTTGCGCGGTTCAACCTTTTGATCGTTGTGATTTTCTCTCGCTGAATATCGCGAGTGTC
TAGACGCTGCCCAACTTTCGTCACAAGGACGAAAATTCCAACCAGGATAGCGAGCGTGACACTAACGACAAGTGACGGAGGGTCATTTCGGTACAAATCA
GGGTGCAGCGCGTAGAATTCCAGGCGTTCCTCCAGAGTTACCAGTACCTCGAGTACATCTTTGATTTGAGTGCAATAGCAAACGGTGAATTCGCTTGTAC
TCGTGCTGTCATCTTTGAAGCACACATCCATTGACCAGCTTGAAGCTTCGGTATCCCATGTACGACATGACGTGGAGAAGTTACTCTGCTCAATAGCTGA
CAGTCCTCGCGTGTGCGGGATTGTGAGAGCAACCAACGGAATCCACTTGGTTGTCTCGGAATTATCTTCATCAGACACAAAACGTCGTATTGATTTGGAT
GCTTGTGTAACGCAAACGCTTGTACTGGCTAGTGTCTCTGTGGTGATCCCGACATCTGAAGAGAAAGCTTTTGACGCGGCAGCCTGGTCAAATGCGGCTT
GGGAATGCACAGAGAACAGCGTTAGCCGAGAAATTGGCTGTGAGCTGTTGAGAGTGCACACAGAATGAGGGCTTCTTACGAACGTGAAGACATCTAGGTA
GATATCCTTATCGAGGCACGCGACTGCGATGGACGTGAGGTTCATTGCCAGCGTGCTCGTCGGTAGAGCTGTAAAACCCACGCCTTTTGAAGAGAAAGTG
CTGACATTGCTGAATTCCAGAATAGCGGACTGTTCGTCTGCCAGTAGTTCTTGGCTGCTAAGTGCCGCTAGTGACTGCAGTGTGCGAACGGTGTTGGCCC
AATTCTCCTTCATCCCAACGGTTTCGACCacgttgctgcaggtgctaGCATCCGCCAGTTTGTTTGAGCTGTCAGCAGATGGTACAGTAATTGAATCTGC
GAGTCGGCGGGCGTTGACGTTAGTGCTAGAACTGGACTCCGAGGTACGCAGCGCTAGTATTGCCAGAATCACCTCGAGCAATGTATCACCTGTCCAATCC
AGAAAATCGGTCGATATATCAAGACCCAGCGCACTATTTGCAATGCCACTGAAGAGTTGAGTTACAAGGGTCACGTTCTCTGCACTCAGCACCTCAGGTG
CAGTTCGCATTATTGATCCAAGGACACACGCCATCTGTCCAAGTCCTGAACTGCTAGCCTCCACGCTATGCGCTGCATCCGACAGTGTCATTAAAATGGC
CGCATCTACCTGTTGAACTCCTGTCGTCTGGATGGTACAACTAGGTCCCATGAAGCCCTCTGGACAAGTAGCAAGGCGACGACCTTTTGCTGCTGAGGta
gctgatgatgaagagccAATTGCTTTTTCCAGCACTCGAGCAGCAGATAGTGCCTGCCGCACTTTTAGAGTTGAGTCGTCAGTAGATTGTAGTGTCCCAT
TAGACGCAAGCAAGCTTGAAGCAAATGCTATAGGTTGTATGTTGACTGCTTCAGGCACCTCCACCTCGATGGTATCATAAGCGATTGTCACCGCTCCCAG
TCTATCACTGATAAATGCCACAATCGTCAACTTCTCACTGTCTTGCATATTTTCAGGAGGCAGCATAGTTGTCATTGCTTGTGGTGATAGTTGGCTCGGC
ACTAGTGGTGTCACGGATCGTTGCAACTGCTCTACAAGGGTAGTTGATCCGTTCAGCAACTCGAAATCCGACGTGGATATCACTCCGAAAGCGTAGGTGA
AAGGGTAATCGCTCACATCATCGCTCCACAATGAGCAAGTGAGTGTGAACACATCCTGCACTGCGTAGCCTGACTCCGGGCTCACTGTAAATGTACCAGA
AGCAGGTGGCGAATTCACGACCACAGAGACTGAGCCAAACCCAACATTACCTTCACTATCAGTAGCCACAAGTCGAAATTCGTACGTCATCCCCGCTGTC
AGCTTGTAGCTGCGGATAGAGTTACTTATTGTCGTAAGAGGTAGTGAAAAGGCGTCACTCGTGTTGCTGGTCGTAGAGTTAGGTAGCACGAGATCACCCT
GGGTCTGCGTCCACCGTGCCGTGTACGGATAGTCCGAACTCACGTCGCTGACAAGTGTCAAACGGTTGGATGGGTTGATCTTGGTAGCAGAAGCCACGAT
GCGGACTATTGGTAGATGGCCTGCTAAGGTCCAAATAGAGCTCGAAGCCGTCGCACTACGAGTGCCCTTGGAAGCGGTCAATGAAAACGATAGCTGCCGG
CCTGGTACGAGGTTGAACGGAGCGATTTTTAATATAGCTCCAGTCATTGAGGATAGATCCAAGGGAGATGAGGTCTTGGCCGATACGTTCATGCACGTAG
CTGGCGTGGGGGAAGAAGTTGTTACATTTGTAACATCCATACATCCCCATGCATATGTGAATGAGTCGTTGGAGGCGTCCGGATCCACTGTTGCAGAGCC
GTCAAGAACAAGTGAGTCTCGCTCACCGAGAGCACCCCCCCCGCCTTTGATCGAAATTTTCGGTGCACTGCTAACAACGGACACCACAATGGATGCGACG
CTTCTAGACGACTGGTTTGGTGACAGTCCACTTATATAAGCTTCAACTCTGAAAGTATAGATCCGTCCAGCCTGCAGCAATGACCGCGCCAAACGGAAAA
CGCGTGGGTCCTGTGCAGAGTTATCTTTACTGAAGTCTTCAGTGGTAATTGAGCTTgtgttgctgccgttctGGCTAGTCGTGGTCCACCGATACTCAAT
ATTTGAACCTGACAAACTTGGGCAGCTCAACACTGAGTCTACCTGCATCATGACAGGAGCGCCAATCTTTGACACGTTTTGAATGGAATCACCCACAATA
AATACGGCAGGACCTGGTAGACTTTGCACATTGGTGGATTTGGCTACCACGGCTGTCTGAGCGAAAGCATTTACAAGCTTTAAGCCGACACGATACGCTG
CACTAGGTGCTAGCAATGAGCTGTTCACTTGAAATTGCATTGCACCCGATATGGTAGCATTCTGTACGACCGATCGAAGGTAACAAGCAGCGCGAAGCTG
CGCCATCGTTGAGAGGGTCGAGAGATCCGACGCTGCATTGGTATTACGCACAGATGCTTGAGCGatatctgcagcaggaatGAGCGTAATGCTCGATTTT
CCAGTTTTCCAGTCGGTCGCGTACTTTTGACAGAGTATATCAAGACTCACATTGAGTCTCTGATACAGCGTTAGCTTATCATTGGCACTAGCAGAAGTGC
TAGCATTTGTTGGATAGAGAGAAGCGGGCATTGCGAACCAAATCAATTGTGAAAAAGGGCGACCTCCAGATCCACTGGAAAGTGATGCATCTACGGACCA
TGTGCCGCAGCTACCCGCATTCTCTGGAGTAACAAGCACAACATTAGGCTGGACAATGTCATTAGGAACCTGAACTGCGATGCTAGCCTGAGAAAAAGCA
CGGCTTGAAGGCCCTGCACGCAGGACATTAGTAGCATTGCAGTATTGGTCGACGAAAGAATTACAATCGTTCAGAACAAGCTTGTTCGCAGCAGCTAGGG
ATGCCCCTGTGCTTAGCTCGATACGTAAATTTTTCCCATCCAGCCATAGGCAAAAGGACTGAGAGCCGAGTGAATACTTGGCAGTAGCCAAATTGAACAC
GAGGCTGCATGAAAATGTCTTAAGCCGAGTCACGTATGATCCAGAACCGCTCACATCCATGGAAGCTGCATGATAGACCTTCGAATCGAAGATAATGTTT
ACCTTGGATCCGGTGCTGTCAAAAGTAGCGTTTACTGGGAGTGGAGGTGGAATAGCCTCCCTGTCATTGATCATCACAACCACGCCCACAACCCCGATAG
AACTGTTGGAAATGTTATAATTCACATCTGCACTAGACGTTGAGTGAATGATCGTAGAGTACTGCGTGGCAGCTTCTGGAATCGCATCATCGATAGCAAA
AATCGTCACACTTCGTGGACGCGCCCAATCCAATGGCGTAAACACCACGTCGATGGTGCGTATAACATCGGTGCTCACCAAggttgttgatgatgatgca
aGGGAACCATATAAAGCTCCAACCTGCGGTTGCATGAATACGCTCTTTGAATCAGCAAGGCTAATAATTTTCTCGATGGTAGGTCGCAACGACACCGTCA
CGTATTCGTACGGCTCTGAATTAAGGGAAATAGCGTACGAATCGTTAAAGCTGCCTTCTGCAACGTGGAGTTGGTTGGTTACGCTTTGAAGTGAGATGTT
AACAAAGGAAACGTCGTTGTCTGCAATATAGAGTGTAAGGTCTccgccacttgctgcataATCGCTAACAGCGTACAGTGGATCTGAGCTCAACGACGAA
TGCGAAATACGAGCCGCGTGTATGTCCATTTCATCGAGCCAATCATCCACAGCAATCAGAGAGATATTCTGCCACACACTCCAGTTCGTAGCACCGAAAT
ACAGCGAGTTTGAATCATTCGTGATACTTGCGTTGCATACACGCTCTGCTGATTGAACGCGCAAGTAGCAATCATGGCTGGCGTTGGGCTGTATAATCAC
GGGTTTCCAAGGTTCAGACGTGAGACGCACACTGTACCGGAGCACGCTTGTGTTACTTTCTGGCGCACGTAGCTCGCGCGTAGACAACTCCAGGCCAGAC
ACATCATTGTCTGTGATAAAGACGCCCACTGCTGTTAGGTTACGCAACCCAGCGTAGATAAGGTCATTCGAAGAAAGCGAGTGATTTAGTGTACTTGAAG
ATCCAATCACATCTTGGGTATGATCATCGAATGCTGCCACACTCACAGTTTGACTCACATTCCAGTTACGCCACGTGAAGGCCAACTGTGTGGGGCTTGC
TACGGCATAGTTTCCCACGGTGCCCACATTCGTGATAGACGTCGTCACGTTTGCAAACGGCTCCGAGGCGAGGACGACGCTGTATGAATCCACAAAACCA
AGTCCTTCGGTCACGAATACCTTCGTCTTACTAATTATGAAGCCCGATATATCGTTGTCGTACACCTTCACATTGATTGTCGGGATCAAAGAAATGGCGT
TGTACTTCGGGTCTTCGCTGTATGAGAGGTGCGAAATGCCTGTCATATGCGTATCATACTCGTCGAGATTGTCATCTGTAGCGCGCACTACAACTGTCTG
CTGCACATTCCAATTTTGTGGTGTAAACAAAAACTCGGTCACAGGAAGCGTGAGGTTGCACAAGCCGAAGCGGTAGCagttcgtgctgttgctgtcaaGC
CAGGGCAGAACAACGATTTTGACGCCGGCCAGCGGCTCTGAGTTTAGCTGCAAAAAATATTGGGCCACAAGCGAGCCATCCTCACTCACCTCAAGTGCAG
ACTCGGACACAAGTACCTTCGCCACATCGTCGCTTTCGACGTTGACAGTCACGTACGGCAGAGGGAGCGCCAAGTATATGTAGTCGTCACTGAAAGTAGA
ATGAGTGACTTTAGAAAACGTCATACTGCCATTTTCTGTCGTGTACTCATCAAGATAGTCGTCTACAGCTGCGAGTCGCACTTGCTGTGGAATACACCAG
TTCTCAGGTGTGAACACAATCCACGGATTTAGCACTGTGTAATTGCAGAGAAATCGTTCCTGTGCCGTTTCATTGGCAATACCGTACACACAGAAACCGC
GAAGACCCAACGGGTCGGTAACATCTGGCTGGAAGACAGCATAAGGGATCGCCGAGCATCTCGGCTTGCCTAGGAGATCCAATTCCGACGGAACAGGTAG
TGGATCTATCTCTTGTGTTACTAGTGACACGTCCATCAATATTTTTAAATCGGCAAAGCGCATGTAATCTTCTAAAGACCATTCGAGTCGCCACGTGTGA
CCTCCGTCAAGATATGGTCCTTCTCGATAAACACGTACGCCCTTGTCAAACTTAATTCCACGCCATATTTTCGTCTCAGGGTCATATTCTGCCTCGCGGT
TCGAACGTACAAAAGAAAGTgcctccagtgcttcatcCATACCCACCGCACTTACATTTACTGGTAGGCGCCATGTTGTACCAACGTAAGACACGTTGGT
ATCTGGATCTAGTAAGTTGAGGCGCAACGAGAAACTACCACCCAAATACGTGCCATTGGCAACAGTGGTAGCGGTGATAACCAGACCTGGGGCTCTGCGC
ATGTAATCGTCTGCAAACACCGCTATAGGAGGGAGGTTGCCGGGGCTGTTGGTGTAGCTGATGATCCATGTGTATCCATTGCAAACATTGAAGGCATCGC
ACTCAACACTGACCCGCGATACATTCACAAGTTCGGTAATACCTAATGTAAAAAGCGCTGTCTGAACAGTTTTGCGCGTCGCATTGAAGGGTAACAAGGT
GGTATTCTTCAGTGAAAGGTTCATCATGTAGGCACGATTTGTACGTGGGTCAGTTTTCTTGAACCAGCCACCCATTTGGACGGAGAAATTTCCACGCAAA
GGCTCGCCATCACGCACAGTATTCACCCCGACAGTCACCCCCTGGCCCGTTAAGTTTACCGACGTCGCAATCATGCTAGATAGATTTCCATAGTTCTCAA
GGAACTGGACCGTCCATGACATGCCGCCTTCGCCAGATAGTCTTTGGCGCGAAACAGTGACATTGCCAACACCCTGCAACTGCACCAGCTTTGATGCAAG
CATATCTGCCGTGTCATTCCAAAATATAGGCGCTGTGCGATTCGGCTTTGTGGGGTTGATCGCATTGTATGGGCTGAAATAGTCAATAACAAAAGCACCG
TTGATACGCACTGGTGACTGGACTTCCGCCAGTGAAACGACTACTTGGGTGGTGGCATCAGCAGCGGCTACCGCATTGGATGAAGTATTGAGCATTAGAT
TTTCGTAACTGGCCACGCTCGCAAACGTAATCTTGTACTCGAAGCCATAGTCGGTGCTGTACAGTATTCCTCGGGAAGTGTTGACGGAATATATACCCAC
TTGTGCGCTCAACATAGTTTGgagtgcagctgctgttgtcaGCATTGGAATTTGAAATATGGTCAAGCCATAACTCAGTTTAAACGACCCACTGGGAGAA
CTTACCAGCCGTACACGCTGGGCTGTCACAGTGCCGTCAATTGCTGTGTTTGACGCCACCGAGAGGAGGGGAAACGTGCCATCAGCACTCACAAAGCGCA
AAAATGTGATATTCCACGTCAATGTTGATTGTGAGTATTGCAAGTCTCGAGTCGCAATGACGGCGTTAGTTGCACCTGGAAACAGCCCATTCAGCGCTGT
TTGGACTTGCTGAGCCGTAGCAAACATATCAAGAGCCACCGTGCTATCGCCGGTTGCGTTTGAGACGATAAATGTACCACCATAGCTCTTGGCAGCTGTG
ACAGCATTGCTTGACGCAAACCGCTGCTTGAATGCATCATTGAACTGGAAAACGATTGCTTGAACTTCGAATCCAAACCCGCCAGATACCTGGAGCCGAA
GTATCTGATCCACGTGCGCCGCATAGGTCACAATCCGCTGTACCTCTGTAAATTTTGTCATTCTCAAATCGATCTGATGGATTTCGCGTGTCGAATTGGT
GCGCAAGTGTACCAGACTAACACTTTGCTGACGAGGCAACCCACACGAGGTCTGGTCAAAGGGATAGCCGCACCGCCGATAACATGCCTTATTCATCTCG
TTGCTCATCGCAATGGTCACGTTGGTATAAGGCTCCGTCATCAGCTGTAGTGAGTAGTAATCCTCACTTGGATAATTCAGGCGCGATTGAGCTACCCCTT
TCTCGGAGAGAGAAACAACTTTTGTAGAATATGTGATATTGGTATCGTCGTTGTCTGCAATGGCGACCACAATGTCTGGCAGCACAAGGTGATCGTAGAC
AGGATCGAGGCTTTCTGACGTTGTACTAATAACAGCCACATGCAAGTCCATTTCGTCAAGGTGGTCATCCACTGCGAGAACTCGCACTGTTTGAGGCAAA
TTCCAGTCATTTCCAGAGAAGTTTAGAATGTCAGGCGTGACAGTGATGTTGCACAGCAAGGTACTGGTGGCCATACTTTCCGTGTCGTCTCCACAACTCA
AGAAAGACTCACTTTTTGAGGTCGCTGTTTCTCCATCCGTGACAACAGAGTGAGACGGACACAGCGGTGCTGCAACGCAGCTGCGATAGCAACCAGCACT
GATGTGGAGAGTCACTTGAACCTTCTGAGTGGGCTCTGAGAGCAGTACCACCTGATAatcattgccattgccatcTTCCGACACACTTAGCGACACCGTC
GAAAACTCGATGCCCGGAACTGTTAGATCCGTAATCGACACTAATGCAGGACCAGTTGTTAAGTTGCTGGCGTACGCGTTAGCTGCAATAATAACTTCTT
GAATAGTTTGTGCGGCCCATTGTACTTGTAAATTTTCTAGCGCATATTGCCGCTTCAACTGCGCACTACTGTTCCCCAGTATTCCATACATTATGAAGTC
TCGGAAGAAACTTGTCACCAACGTCTGAAAATCTTGGAGGagttcttggccaccaagGGCACTGTTTACACTAGTAGTGCTAACTGTTGATGTGAGTTGA
AACAACGGTGAGCTGGACGCTGAGTGAAAAATTGTCGAGCCGTGTAACCCTTCATAGAGTTGATCGTCTGTGGCAAGCACGTGTATAAGCTTGGGGGTCA
TCCAATCCTCCGGTGTGAACACTAGCACTGACGGTATGGTAGACACATTGCAGAGATTGAAACGATAACATTTGTTCTCTGCATTCGTCTTTATGATGAC
AGGTCGCAGTGGCTTGGCCGATAGTCCGATGGAATACGTATTGTGAGCCCCAGTAACTTCAGCTATAACCCCTTCGAGAAAGTCATGGTAGTGATCCAAG
ACCTCTGTGGATGACAATGCGCGAACATACCACGCCACGCTGGCAATCCTCCCAATAaagccaccatcaacagTATTCGAAGAAACAGCACTATTTGTAA
CCACTGGAGGGGCTCCAAAAAGGATAACCTTCTGCGATAGATTCAGCAAAGCCATGCTGCACGTCACAGTGCTTGCATAGCACGTAGTTACCTGCTGTTG
CCGCGAGATACAAACAGAAAgtgagacgctggaggaTACAGGGTCGTACATTGCTACTAGTTGATGCCATATCCCCGCAACAGGAAGGATATTAGCGTCT
TCGTCGAGGGCTGCTTTGCATGTTGCCCCGTCGGTGGGATTTGTTACCACGAAAAAAAATCGAGCAGGTTGAGCACCAATTCCGATGTGCCCGAAGGCTA
CCTGCTCTCCGTTATCGTTAAGACCATATATGTTAAGTATCGTTGCAGGCAGAAAGCTTGACGTGACCACAAAATTATCACCAAATTGCACCCAAAACTC
CACCGAGAAAGAGCTCATGGCCGGCTGAATGACGACTGTAGTCGAGAAAAAAGTGCTCTCCATGGCGTCCCGAATGTTCAACGACGTCCAAGCCGAAAct
gtctgcagctccaggaagctTGTGGTTCGACTATACCCTTGGTATGATGCTGCTTTAAAGTTGGTACTAACAAACACTTTGGCACCATCGTCGAACGGCC
AGAGAACTACCGGGTTGTCGCGCAATAGTAAAGCACGATGTTCGTTCTGTGACAGCGGGAGTCGACCGACTGGCAGCAGCGCAACTTTACCGAGAACCGT
AATATCGACGAAGTCGCTGAGAACCACACTATTctgagcagcatcttgagcgcGCAAAGGCTTCTGACACGCACTATCTGTACAAATAAAAGTGTTACAT
GATGAGGATGGAGCGACAACGGCCCCCATCGCAGTTAATGCGCAAACGCTGGATGATCCTTCTGAGGCTAGAGCTAGTGCTGCAGTTTTACTGCGAATAC
CGTTAAGTACGGAACCGTGAGATGCAACGGAGAGCTCCACTACTGGCTCCACATTGACAGATGAACACTGTGATACATTTAAGTTGACGTCAATAAGTCC
GATTCGTACAGGTGCTCCGAAATCCAAAATCACCCACTCATGAAAGGAAGGACTGCTAGCCACATAACATTGGGCGTTGTCCTTGTGATTCAGTAGCGCA
TTCGCTGATCCAGCACCGGAACTATTGAGTTGCGAGCTCACGCTATGAATCTCATACGGTATAGGGACTGATGGGGTTTGTTCAAGTGAGTCCGTTGAAG
CGACATTGCTTGGTGGAAACACTTGGACGCTTGCGACCGCAAGTGAGTTTTGCCCTTTAGCAAAAAAGTCCAATAACAGGTAACGAGACATCGTGGTTGG
GTTCCAACGCACTACTTCTACCTCGTTCAGCATCAACACACCAAGACCACGCTTCCTCACAGTCACAAATCGAGCTCTTGAAAAGGCCCCATCCCACGCA
ATAGAATCCGAGTAACCTGCGCACGAGAACGACAGTGTTGTGCTAGTAGTAACCTGTGCTCCAGACGCCGTGCCGTCGCTATTTCTAAGCGATAAGTCAG
AGAGAAGTACCTCGAAATCCTGGACAAACGGGGCATTTAACTGTAGCAAAGAATCCACACGGCTGTAGTTGTACAGATCATCGCTCCACGTCGGATACCC
GTTGCCCCCACTCAATGTTGTCGGAGCGCAAAGCTCGTTGTAATGACTTCCAACGTAAGGATAAAGCACGACAGAGCGGACAGGCTTGACGCTCCCAAGG
TCTACTTCCCACCATGGATCAGTTTCCATGTCAGTTCGTGTACTGCCTGCCGCCATCGTACTGGTGGTTTTATCCTCAATAATAAGAGGGTCCCACACAG
AATGTCGAAGCCCGTCCACAGCTAAATAAGACAGCGCACCTCCCGGATTTGTGCTACTTTGCCTGGCAGCCATACCAATTGCTAAATTTTCGTCCTCAGA
TTTCCGAACAGTCTGCAGAAGACGCCAtggttgcagtgctgctgtaTTTGGCCCCCACGACGCTTTCGATCGTGAACGAATACCAGTCCCATCGGCTGTA
GGGGTCACTAATATGAAAGATTCAAACGCTTGCACTTGGGATAGACTTAACGTCCCAACCCCCTCGCGGTAAATGCGGACTGCAATTGCACCACCTTGAA
TATCCCACAGCAAAATGCCTTTTCGGACAGGCAAGCTCTGTACATGGGGACATAAATTTGGACATCCGTATACGAGAGCATCTTCTAGTGATAGCGGTCT
GGAACTGAAAGCCGTTAGAGAAGCTATTAGCACGATCTTGACAACATTAGAGCCTGTGCTGCCATTGGCAATAGACGCCGGCAGAAAAACCGCTAACGTG
CCAAGTTTTGTTAGTTGAGGAAGCGTCACTTCCCACCACGGTTCACTTTCACTGTTTGTCGTAGCAACTGCGACGCTGCTATTGACTTTATCGTCGTAAA
TCACTCCGCTGGTCGCGAGTGAGGCTGATAAAGCTGTATTCGTCTGCGAAGATACTGCAGTTGAGCTTTGTGTTGCAGCTAAACCATTCAGGATATTTGG
GAATTGGTACGCTAGAGATAGGAGAGGGCGAAGTTTTCGTTCGAATACCGATGAACAAAGTTGGGTCGTGGAAATCGACTCGGTGCTGTTTCCTTCCGAC
AGAACTTCAATTTGCAGAGACACCACGGACATCCGCGTTGGTAATACTTCGGTTAGCAGTGTAGAAATATCAATCACGATGGAGCGGCTCTTCTCGACGG
TCGCAGTCACTTCAATTGATGGTCCATTTGGTAGGAATGAGAGGGGTTTAGGTGATACTTTTGCGGCACCAATGCTCTCTGCTGTCCAGGCGTTATCTAT
CGCCGTCACCTTCAGTAGATATACCTTAGAAAAACTCACTTGACCTACCGAGGAACCATTCGTTCCTGttgacgagctgctgctgctctggagTTCGGAT
ACATTAAACACCTTGTAAGGTGTTTGGTGAAGCACCAGAGTGGCCCCAGAGAACGCAAGTGCCGTGTCCCCATCGTGTAACTGCGGTAAATGAAACTTCA
TATACGTCACGACATTTGCTGCGAACACGAGGATATTTGAGAGCGCAGTTTTTGTCGTCACATCTCCTGCCGTAGTTGTGGTCAGTGATATATCATGAAA
TGCTAGTGCCGTCACGTAGTCACCTACCCATCGGATCATCGTATCAGTAGCCTCCTTCGTTGCAAGCCCTGGTCGTGGCTGGTTGACTACCACATTGACC
TTCGCAGCATCGTTATCTCGCACAAACACATTGACTTTTGAATGACCAGGTGATCGAAGGACTGTAGGCACTGGATTGTAAGGGATATTACCGCCACCCA
CAGAATTCCATAGTGGTAAAAGATCGACACCAGCCTGGGCAAGCGTGCCCTGGAACCAAAATGCAGTCATGTTAGTGTATCCGTAAGGTGAATTCTGCAC
TCGATGCGAAATTGTATAACTTGCATCGAGctctgcttcagcatcatccACTGCAAGTACCATCACGCGTTGCGGTGCGAACCAATTCGTCGCTGTGAAC
GTTAAAAGCGAGGGAGAGACCGACACTTGCGAGTTTCCGATAATCGCGATGCTCACATTCGGCGCTACAACGCCCTGCTGGGATTTCCACGCCGACTGAT
CATAGATCGTAGCAGCAAGAGCGGAAAAACCCTCGCCCCAAAATCCACAGATATCCGATTGTTTGACAGTACAATAAGTGGAAGAAATTTGAGGTGTGCT
GGTACTAGCAATAACCTGTGTAAGTCCTCCAATCGACGGTGGCGCGTTGAGAACGACATCATAAGCCCCCCTTATCCCACCTTCAGTAACATCCAACGAG
GCAGTCGAGAGGGTAACTCCAGGATCGTTGTCCCAAATGCTCACGTTGATGATGTTGCCAGGAATAAATCTTGCCATGCCACAGTTCCAAGCGTGTCGCT
CCAGCGAGTAGATCTGTGGAAACATCGCGATAGTGGCATCCAGCACACGTTTCGCGTAGCCTGCGGGCCATTCTTCAAATGCCCAACGCATTGTTTCCAA
TCGGACCAGTCCTGCACAAATCGTGTGCAGCGTATTTTTCGGATTTACACTCATTTTCTGAGCTTGGTTGACATTCATAAGCCCAAGGAAGCTCAGTATG
AATCCGCGAAGTTCGGGTGGAGGCTCCACGTAGTTCAATTCGGAACTGGTTTCATTTCCTGATGTCGATGAGAGTACGGTAAGGTTCACGTCACTTGGCC
CGCTTCGAAGCACATCGCGAAGACTCGCATAACTCATGTACGTTACACTTTTGTCAGCAGTATCAGGGTCTAGTGGCCTGCTCCCAAATCGTGCAGGTAC
CTTTCCACCCCCGTTCACCACGTTGGCAATACACGCACCATTGCCCAAAGAAAACGCACACTCGTTTGTAAGGTCGCACACTCGAACAACAGTTTGACCA
ACTTCTAACATCGTATCAGGTAATAAACAAACCGATGAATCCAGCGGGTCACAGTTAGGTACGTCAAAACACTGTGGACGGCGAGTATGATATCGAGCAT
CCTTGCTCTCAGCGTAGTGAAGCAGCGGTCCCCCATTGTAGAGGCCCCCGTATTCCACCTCTGACTCGGCATCATCTACGGCGTCCACCACAATGCGCTG
AGGTGTATCCCAGTCCCCTGGATGGAAAACGAGTTCGGCGGTACCGTCCGAAGTCGCGTATATCGGCGATTCTGGTGCTACGGCCGTTTGGTTTCCATGC
AGCGGCACGACCACGACCTTCACAGGATACCACGGTTGTGAGGTTAACACGACATCGTAACTATCCTTACCACCACCCTCAGCGACAAACACATGCTGTC
TCGAAAGTGATATGCCCGCGCGGTCGTTGTCGTCGATCTGCACGGTCACATTGCGCCCGGAAAGAAAAGGTGtctcagtgccatcaaaGTTTGGGTCAGC
ACTGGACACAAAGTGTGTCACAACGGCATAATGCCTACCTTCTGCCAGCGCATCATCCACAGCTTTCACGCGCACGTATTGCTCGCGGTTCCAATTTGCC
GGTGTGAACAACACGCGCTGAGATGTCAAAAACATGAGCTGATGAACCGGTTCCCCACTTGGATCTAGCAGCCGAACATCTTCCGCCTGTACTACAACAT
CCACGAGCGGCTGGCGgttcagcaccacagcgtACTCTGCAACCAACCCTCCCTCTCTGACGCGTTGTCGCCGCGGTGTTAATGTCACCCCACCATCCAT
AGCGTAGTCTAAAATATCTCCGCCAGAATTCAAGCTTACGGCAAAATCGTACTTCCGTTGCTGCGTGCTGGTCCGCGGTTCCGGGTCCATAAGCTGTGAT
TCGTAGTCGGATATCCCTTTCGCCTGTGTCCTGGTCTCTAAGATATCAGCAATGTCCACTTCCACGGTCTCATCCAGCTGATTTGTTTCGCAGCCGcccg
agagcagcagcgtgttgAAGTTTCCGTCCAGCGAGACGCCGTAGACAAAGTCGTTTGCAGTTGTGCCGAACTGCGTGAATGCCACAGCACACAGAAAGGC
ATGAGCTTATGGCCATCACTGGGGAAGTTCGTAACGAGTCccaagagagagagagagagagagagagggcCCCGAGTGACTCAATCAGGAAGTCCCAAAG
TACCTGCCGCATCCAGAGTTTGTCTCCGTCCAGCGAGATCTTGGCCAGCGCCACGTCGCGTCCTCCGTAGTGGCCGAAGCCGTTCAGAGCGTGGCCTCCC
TCGTCCAGATAGCCCCAAGTGTATCCTGCCAcgtagagctgctgcgtcaTCTCGCCAGTCGACGACGTCTCGTTGAGAATCGTGATGAAGGTAGCTGCGT
CCGACTCATCTGTCCCATACTTCAAATAGAAATCAAGTCAATaatgcacttcaacgtgacAATAGAAAGGGGACACACCTCTCTCGTCCACCCGAGGCTG
CCGTCTGCATTTAATCTCGCTACAAACCAGTTGAGGGTATCTACGTCCGAAGCTGTGAGGAATTTGGAGCCTGCAAAGTACAAATTCCCGTCCAGATCCG
CCACACCCTGGCCTGTGATGTGGACCACAGCGTTTGGCTCTGTCTGTTGCCAGTCAAAGTCTTCTTGGGCTGTGAGTCGCCAGGTTTGGGCCTCGTCTGG
AGTCAG