Description :
From Genome Similarity Track
Location :
Scaffold_263:9653- 11288
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_263-fgenesh-gene-0.7Vacuolar protein sorting-associated protein 8

Sequence
1635 bases(100 bases per row)
GGCTTGGACAGAGCCACGTTGCAGTAGTTGCACGCATTCGACGGCGGTGCGTACGACCGCGAGCGAGCGCGCTTGAGCGTCACGATCTGGTCAAACAGAT
CGACACTGATGAGCCCATTCGCCGTCTGATAAATGTTCTGCTCGTAGTTGTAGGTGTCGAGCATGCCAAAGATCGTCGGACGGAAGTCACCAAATTCGCC
CTTGCCGTGCTCGTTCGTGATCTTGAACAGAATCGACTTGAGCGACACCGACGACGCCATGCGCTCAAGGATAAAGCGAATCATCTCGTTCAGCGCCACC
TGGAACGCCGTCTGAGCACCACCACCACCCGTCCGCGTCGTAATGCGCGCCGTCGTAGCCTTAGCGCTCACTGACCGCTTCACCGCATTTTGAATGCGCA
GCAGCTTGTCCAGGAGCGTGAACCACAGCTTCTCAGCCTGCTCGTCGCGGTTGCGCAGCGAGTTACGCTGACACATGGTCAACGCCACCTCGACAGACTG
CATCGCGTCGCGACCCTCTGCGACACTTTCGATGATACTGTCCACGATCTGGTTGCGCGTGCCTGACGGGTTACTCCCACTACTCAGCAATTCCCCGCTC
GCCGACGACGCCGCGTTGTATCCGCGCAGGGCAGGCTTCAAGATCTTGAGCTTCTGCTCCAGGCTCTGCAAAATGAGAGTCAGAGCCCCCGTCACGTCAC
CCGTTCGCTCGAGGAGGTACGCCTCCGCATCGGTGATGTTGAACTCCTTGCACAGCTTCAGGCACGCGTCCACCTTGTAGCTGTCATGCGATTCCAAGTA
CGGGAACACTCCCGACGGCTCGTACTCGCACAAAAGACGCACAAAGCGCTCCTGAACAGCAGGGTCGTCGGCGATACGCAGTTTCGACCGATCAAGGAGC
TCCTTGACAACGTCCGCTTCTTCGCCGAGATCCACCTTGTTCGTATTCGATCCTGACAGCAAGTGGCGGAGGTACTGGAATTCGAGCTTGGCGCCAGGTT
TCCCCATGGACAGGAACTTCTGGATCACCTTGTTGTTCAAGCTCGGGAACTGCCCCAGGATGAGCACGACAAATGCGTAGCCGTCCGTCTCCATCAGCGC
ACCAGAATGTGTCAATACGGCTTCCTCAATGATCTTCTGCCGACGTCCACCATCATTCGAGTCTTCTTCGTCGACCACTTTGTCCGTTTCTAGAGCAAGT
TCACGAGTGATACGGTTACAAACAACAGTCCACAGCAACACCGAACAACAAATGGGTGACACGTACCGACACGAATGTAGCTGAACGCATTGATCCGATA
CTCTTGGTCGGCGTCGTCGAGATACGAGGCAATAGCGTTCGAGATGTCGCCCTTCTCCTTGTACAGGAGAACAGCTGCGCGGTTCATCTTCTCCTTTGTC
ACGCTTTCCAGGAGCGCCGTGTGGTCGTACGCAGCCTTGTTGAGATTCAGCAAGAGTCTCACGAGCATCGCTTGTCGTCCCGCCTTGTCGAAGCCCTCTT
CTTGGGACACAGCTGTGGCTGCGCTCTCGGACGTCCCACTCGACAAGAGCGACGAAGGTCCGAGCGCCAAAAAGTTCATCAGCGAGTCCATCATCGACGA
ACCGCCGCCACTCTTGTCGCCAATGGCCTCGGCAC