Description :
From Genome Similarity Track
Location :
Scaffold_761:9653- 11230
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_761-snap-gene-0.9Mediator of DNA damage checkpoint protein 1

Sequence
1577 bases(100 bases per row)
GCCACTTGGACTCGGCCTTGGCGTCCTTGAGGCAGTGCGCGCGCTCGTAGATTGGCGCGCCGACCCGCGCCGACTCGTCCAGCCACCGCTCATCCAGCAC
GTGCGCACAGCACGAGATGCCGCACAGCATCTTGACCGTTCGCTTCAGCTGGTCCTTCGGTGCGATCACATGCGTCGCCTGCTCAACATCGTCCTCGTAC
ACCGCCGACGGGATCGCGCGGATCTTTTTGCGCACGGTAGGGGTCAGCTCGATGCCAGTAAGAATAATCCGTATGGCAGGCGGGGCACTCGACGGTGTGG
GATCAGCCGCGGATGAATTAGCAGCATTCCCTTCTTCTGTCGAACGATTTGCCTCAGCTGCGGGCTCGTCAGCGCCTCCGCCACCATCTTTGCTTGCACG
AGCTTTGCTTACAGGAGTGCTGGCGACACTTGCATCGTTCGGATCGTCCACTTTGCGCTTCATCCGCCGACGCTTCGGGTTGATCGGAGTGGCGGGTGCG
TCCGCCGCGACATCGTTCTCTTCTGTCGTCGTGGATAGCACACTCGATGAGGCAACAGCATCTGATACTTCAGTCTCGCTCGTTGCCGAGTCAGCTGCCG
CCTTCCTCCGGTTTCCACCACGCTTGGTCACACCCGTCGCTGCATTCTTGGCGCGTTTGTCGTCTGCCGGAGCGTCGATCGCGTTCGTATCTGCGCTAGT
CGACTCAGCGCTGGCATTTGACTTCTTCTTTTTAGTGGAGCGAGTAGGAGTGCCTTTGGATGTGCTCGTGGTCGCCGGGACAGCAATCTCAGTCGTTTCC
TCATCGATCGATTCCGATTTAACTGGGGATCGCTTCCGCTTCGTGCCACTCGCCGGCGTTTCGTTGGATGCGGTCTTGCTTCGACTGCGGCTAGCGCGAG
CGGGCTTTGCAGAGGACGACGAGACTTCCGCGGCTTGTTGACGATCATTTCCAGGCTCGTGAGGCGCGTCGTCCACCACCACCGTGTTACCGCTGCGCCT
CCTGGTTCGAGCATTGATAAACCCAGCAGGGGACGAATTAGCGATAGGCTTCTTGCCCGTTTTGCTGTCCGGCGTGAGCTTCTTGCGCGCTCGTGTCTTT
TCTTCAGCCCCAGCTTTCTCCACTACTCCTCTTTGTCCTTCGATCGTCTTCGACACTTGGTCATACCAATAGTCGATCCGCGTCCGTTTCTTCGACGCAA
GGCAAATGGTGGCGGCTTCGGATGACACCACGAGGTTCCAGTCCTTCTCGCCACTCTGCTCCTCGTTGATCGTCAAACCACCCTTGGTCATGTCAAAATG
TGTCAACAACTCGTGCTTCTTCCATCCCTTGAGATCGAAAACTAGTAGCTGCTGAGATGATAGCACGATCTCGGCCAGTCTCCACGTATGCTCCCCGTTC
TTGGCCTTGTCGCCGACAATGCGAGCCCAGAACAATCCAGGTATCGGGTCGTCATGAAATGATGGAGCTTGTGCAAACAGATGACAATCAACTGCAGATG
TCACTAGCGCATCTGGCAGCTCGGCGGTCTCAGACGCTCGTTCCTGGCTGAGCGATTTCGTCCGCGAATCGTTCGAA