Description :
From Genome Similarity Track
Location :
scaffold_45:9649- 10804
Transcript NameFunction/comments
Plaha_PHALS_10545Ca2 /calmodulin-dependent protein kinase%2C EF-Hand protein superfamily

Sequence
1155 bases(100 bases per row)
CAGTTTGCATCGAAGTGCAGCCTTTAACTTCGTGTTCTTGAATGTAAACAGACACTACTGTCAAATTGCTTATCCTATAACCGGGAGATTTTGTACTTAC
ATCAATTCTATGACTTGTCTGCTTCAACACTGAGCGTCGAATAAAATCTAACGGATCCCCTTCATGCATCAATCGGCTAAGATGTTTCTTTCGACGTTGC
TCTGCTAAGCAACTATGACGTTGCTCGTATATTGGTCCATACACTAGACGCATGAACTCATGGTATAATAATTGGCCATCATGGTCTTGATCATACGTAT
CaaaaagtttttttaattgtGATTTCGCAATTTGTAAGCCTTGACGATGTAGATTATTCTCAAGCTCTGACATGGTTATACTGCCACTTTTATCAATATC
CCATGCACGAAAGACGTGTTGAAGTCGTCGGGACTCATACTTGGCCCGTAACAACGAGACCACACAATCCGAATCTAACGTCGCAATATTAGCTTTGTCC
GGCTGATCATTATTTTTTAACTGTCTGTTGTTTGTACAGCTAGTAAAGTTGGTCTCTACCACTTCGTTTGGCTTTGGATTACCATATACAAATCGACAGA
AATCATCATAGCGAAGAGACCTTCAAATTCAAAGCATAATCAGCTTCAAAAGATTTTTATCATCGAATGTCTTACATATCACTGACCTAGTCGGTAATGC
GTCAACGTAATCAAGAATAGCGTCGATTTTCTTTGCGCCAAGAGCTTGAGTAATACCCAATTGAGTCAACATTTTTCGAACTTCTTCTGTACATAGACAA
CCGTCTCTATTGGTATCCCATGAAAGAAACGCTTGACGAACACTACGTTTTTCCCCATAACGGTCGCNNNNNNNNNNatcaccgaccttttgttcttcac
aagaaccagtacgagtgtagcggatcgcaatccgctacctccaagagtagttagaacctTATCCCAGGGCTaaaaaactcttctgtttagaatgtaaact
gtatttatttgttttatctgcggcaaagccgcctaattttaaatgtatagattttNNNNNNNNNNGTGGGTTGCGTGTGGGTTACATGCAAGCCGCACCT
GGGTTCCGGGTGCATTTCCAACAATTGTTGTGgagccaagaaacgagctcaaaga