Description :
From Genome Similarity Track
Location :
Scaffold_212:96454- 97642
Sequence
1188 bases(100 bases per row)
TGGGAGTCGCCTTAGGAAAATCCTTTGTATAAGGATTTGATCGAATTCAAGGACGTGTTCCTGAGTCCGTACCATGCGAATTGCGTTAAGATAAAGGCAC
TCGACAAGAAATCGAGCTCAAACCGGGCATGAAGAACTGTGTCATGAAGCAGTGGCCACTGCCTCGTAAACAAGTACTTGCGATCGACAAGTTCTTTGCC
GATCGCTTAGCTGCGGGTAATGTGAGCGAGTCAACTTCCCCTCACAGCTCTTCGAACTTCTGTGTGCGCAAGACCACTGGAGTATGGCGGATAGTGCACG
TATTCAATAAGGTGAATGCTGCAACGGTACCGGCTCATACGCCGATACCGAGGAAGTACGTAATCATTGATGGCATGTCAAAGAGTACTATCTTTTCGTC
CATGGATCTGATGGATGGATCCTATCAGATTCCAATGCGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGTATGCTCTAGGATTGACTA
GTAATGCCACAACGGATTAGCAACGCCCCTGCCACATTCAACAGATGTGTTACAGATCGGTTGGACTGGTGCGAGGCTTCGCACCGAGTTACTTCGACAA
TGTTCTCGTCCATAGCCGGGCTATGAGAGAAAAGACAGACGTAGAGGTTCATGGAACTCACGTTCGTCAGGTTGTTAAACTTATGCGCAAGCATAAGCTG
AATGTCAACCTCAAGAAGTGAATATTCGCTGCTAGCGAAACACCACTTCTTGGGTGCATCGTGGGTAAACACGGCTTACGCCCTGATCCAGAAAAGGTTA
AGGCGATTACCGACTGGCCTGTGCCAGTAGAAGTTAAGGAACTAAGAAAGTTCCTTGGTCTATCGGCGTGCTTACACAAGTACTCGCGCAACTACGGCAA
GATGACCGTTCACCTCTCTCGTCTTTTTCAAAAAGAACGAGAAATGGTCATGGAACGCTGATTGTCATCGTTCCTTTAAAGGCATCAAGCAGAGCTTGAT
GCAATCGCCCATCTTGGAGATTGCAGACCAAGACGGACCATTCCATGTGGTCTGTGATGCCAGCGATTTCGCAATTGGCTGCGCGTTAATGCATTACGAT
GTAGACGGAGCAGAACTTGTCACCTGTGATCAATCCCGTCAACTGCAAGTAGCTGAGCTTAAGTATCCAGTGCATGACATGGAACACC